According to the sequence of events described in The Riddle of the Rosetta Stone, what leads the scholars to believe that the three inscriptions say the same thing in different languages?

the discovery of the Rosetta Stone by soldiers
the letter sent by the army officer to the scholars
the appearance of the ancient Egyptian hieroglyphs
the translation of the last sentence of the Greek text

Answers

Answer 1

Read the excerpt from The Riddle of the Rosetta Stone.

The French army stayed behind in Egypt—and so did the scholars. In late August, shortly after Napoleon's departure, a large, heavy package arrived at the scholars' palace in Cairo. When they opened it, they found it contained a black stone slab covered with writing in three different scripts.

A note from a French army officer accompanied the package. He told the scholars that the stone had been unearthed in an old fort near the town of Rosetta, thirty-five miles north of Alexandria. French soldiers were tearing down a ruined wall in the fort when they came upon the slab.

Answer:

the translation of the last sentence of the Greek text

Explanation:

According to the sequence of events described in The Riddle of the Rosetta Stone, the scholars are led to believe that the three inscriptions say the same thing in different languages because of the translation of the last sentence in Greek which confirmed to them that the inscriptions mean the same thing.

Answer 2

Answer:

D. The translation of the last sentence of the Greek text

Explanation:

Its Right:)


Related Questions

are there any jobs that should be switched among federal, state, and local governments? why?

Answers

health should be federal not state, some states don’t require certain things and socialized medicine could help greatly among terminal and chronic illnesses

Describe Anne Frank’s life before she went into hiding with her family.

Answers

Anne Frank was a perfect and regular girl. She went to school and everything. Suddenly, the Germans began World War 2, and things flipped around for her and the whole Europe. She was a young girl, and she had a sister.

__ were less expensive to maintain than paid employees.

Answers

Answer:

hoii

Explanation:hi

Answer:

Machinery

Explanation:

Automated machienes are way less easy to maintain the humans.

How did the ability to write change the lives of people from ancient Sumer

Answers

Answer:

They had the ability to take inventions that had been developed ... of the modern technologically advanced world that we live in today. ... Other ancient people made pottery by hand, but the Sumerians were ... An early writing sample from Mesopotamia using pictographs to create a record of food supplies.

Answer:

In the explanation. :)

Explanation:

A few thousand years later, as variations on the two systems spread throughout the region, the entire ancient world had writing schemes that vastly improved the efficiency of economies, the accountability of governments and, maybe most importantly to us, our understanding of the past.

Reading and writing in ancient times wasn't for the masses, however. Daily life in Mesopotamia and Egypt was time-consuming, and so writing became a specialized profession, usually for members of the elite class. The highly-regarded scribes of ancient Mesopotamia were even depicted in art wearing cuneiform writing implements (a bit like a set of chopsticks) in their belts as a mark of their importance.

The idea that the court should play a more active role in creating national policies and answering questions of conflict in society is the best definition for________________.

Question options:

A. checks and balances
B. judicial activism
C. separation of powers
D. judicial restraint

Answers

B because they are asking the court, which is the judicial branch, to be more proactive. hence judicial activism

The idea that the court should play a more active role in creating national policies and answering questions of conflict in society is the best definition of judicial activism.

What is Court?

A court is refer to a legal system where decisions regarding any crime or offensive action or dispute are made with the help of a magistrate where both the victim and culprit are presented.

technique of using legal challenge or a characterization of a specific court ruling in which the judge is often seen as being more willing to rule on constitutional questions and to reject legislative or executive measures is referred to as Judicial activism.

In this activity, the court should play an active role in answering the queries related to any conflict present in society, and developing national policies and other legal proceedings are considered traits of judicial activism.

Therefore, option B is appropriate.

learn more about Court, here:

brainly.com/question/16932522

#SPJ2

Which action would most likely help group discussion participants work toward discussion goals?

Answers

Answer:

its A) connecting their ideas to others’ ideas

Explanation:

The action that would most likely help group discussion participants work toward discussion goals is connecting their ideas to other ideas Option(a) is correct.

What is the goal of discussion group?

Rearing new thoughts and taking contributions from a specific group. View of everyday citizens on a specific theme. Distinguish an answer for a particular issue or issue.

Choosing competitors after their composed test for recruiting in an organization For a discussion to be powerful, understudies need to comprehend the worth of effectively paying attention to their friends, enduring restricting perspectives, and being receptive. They likewise need to perceive the significance of remaining on track and communicating their thoughts obviously.

An illustration of a discussion is when at least two individuals differ and choose to plunk down and work out their various suppositions. Discussion or discussion concerning a specific subject. There was then a significant discussion of whether to underwrite words like "east".

Therefore Option(a) is correct.

Learn more about Discussion here:

brainly.com/question/18599469

#SPJ2

What was a result of the French and Indian War that directly led to the
American Revolution?

Answers

The French and Indian War began in 1754 and ended with the Treaty of Paris in 1763. The war provided Great Britain enormous territorial gains in North America, but disputes over subsequent frontier policy and paying the wars expenses led to colonial discontent, and ultimately to the American Revolution.

Which idea is part of the philosophical tradition of connfucianism?

Answers

Answer:

Virtuous behavior is necessary for a good society.

~I hope I helped you! :)~

what are the motives of each of the 4 regions of the united states to support the union as a whole? (Paragraph 7)

Answers

Answer:

Regions in the United States are areas that include different states. The five regions are Northeast, Southeast, Midwest, Southwest and West.

Explanation:

Which of the following best describes the spatial pattern of adult literacy rates presented in the map?


It provides an economic perspective on the productivity of each country’s workforce.

It provides an economic perspective on the productivity of each country’s workforce.
A

It provides an economic perspective on earnings for each country’s population.

It provides an economic perspective on earnings for each country’s population.
B

It provides a political perspective on each country’s level of civic participation.

It provides a political perspective on each country’s level of civic participation.
C

It provides a political perspective on each country’s system of government.

It provides a political perspective on each country’s system of government.
D

It provides a perspective on each country’s level of social development.

Answers

Answer:

D

Explanation:

How long was the Trail of Tears?
A. 250 miles
B. 450 miles
C. 650 miles
D. 850 miles

Answers

The answer is D. 850 Miles

The members of the Church of England who claimed that the church had not given up Rome's
offensive beliefs and practices were the
Puritans
Presbyterians
Methodists
Baptists

Answers

Answer:

Puritans.

Explanation:

The Puritans are a group of English Protestants who hold the belief that they need to purify the Church of England and its practices of Catholicism. Their main objective was to reform the Church of England and rid it of its Catholic practices which seemed too authoritative and discriminating for them.

These Puritans believe that the Church of England still practiced some of Rome's offensive beliefs that were not according to what God wants or teaches. Thus, the correct answer is the first option.

Answer:

The Puritans

Explanation:

I went on the test, and I got it right. Promise. (:

The term interglacial refers to

Answers

Answer:

a period of milder climate between two glacial periods.

Explanation:

Answer:

it refers to a geological interval of warmer global average temperature lasting thousands of years that separates consecutive glacial periods within an ice age.

Explanation:

who was the strongest Mauryan emperor​

Answers

Answer: Chandragupta

Explanation: Chandragupta was the most powerful Mauryan Emperor.

Help Just click the picture and you can see clearly

Answers

answer: the u.s constitution

Answer:

Magna Carta

Explanation:

The Magna Carta, drafted in the year 1215, is one of the earliest pieces of evidence of a limited government. The document limited the reach of the English king's power by giving the country's nobility rights that they could exercise over the throne

How did Hoover react to the economic crash? commint lit

Answers

He asked individuals to tighten their belts and work harder, and he asked the business community to voluntarily help sustain the economy by retaining workers and continuing production.

What role did women play in British Colonial society?

Answers

Answer:

Housewife

They were needed at home to run the house by making meals, cleaning, raising the children, and many other things too.

Which of the following regions has a culture based on a mixed African and European heritage, meaning that people practice diverse religions and speak diverse languages?
A.
Mexico
B.
Brazil
C.
Central America
D.
the Caribbean

Answers

Answer:d the carribean

Explanation:I don't have an explimation that's just the answer

Answer:d

Explanation:

2. The most democratic country among the following
A.Iran

North Korea
Germany
Saudi Arabia​

Answers

Answer:

germany

Explanation:

they have a democratic index of 8.68 while Norway is the highest

which statement best describes President Lincoln's view of the Reconstruction of South following the Civil War ​

Answers

Lincoln believed that the South had never legally seceded from the United States, so he planned to forgive the South for the past. He issued the Proclamation of Amnesty and Reconstruction in 1863 to announce his intention to reunite the once-united states.

what is the difference between gilded and solid gold?

Answers

Answer:

With so many terms to describe jewellery, we explain the difference between solid gold, gold-plated and gold-filled jewellery. Solid gold is the most valuable and durable form of gold. Gold-plated is a very thin layer of gold coating a piece of metal, gold-filled involves bonding a small amount of gold to a base metal.

Explanation: :D

Which group made up the majority of the population of Texas during the 1830s?

Answers

In eastern Texas 20,000 settlers and 1,000 slaves outnumbered the 5,000 Mexicans in the area by 1830. That is all I know don't know if it helps sorry.

How did wars in West Africa affect the slave trade?

Answers

The slave trade's effect on African societies

The use of African slave labour was not new. The Spanish and Portuguese had been using African slaves since the 16th century. However, the Atlantic slave trade of the 18th century was a new kind of slavery and was on a scale much greater than ever before.

The implications of the slave trade included:

Effects of the trade on African societies in West Africa
The slave sellers and European ‘factories’ on the West African coast
The development of slave-based states and economies
The destruction of societies
The development of foreign colonies
Leaders of African societies took roles in continuing the trade

This took time would love to have brainliest.....

Answer:

hope it helps

Explanation:

As it gained momentum, the abolitionist movement caused increasing friction between states in the North and the slave-owning South. Critics of abolition argued that it contradicted the U.S. Constitution, which left the option of slavery up to individual states.

ANSWER QUICK!!!!!!!!!!!!!!!!!!!!!! PLEASE
How did the Third Crusade lead to the Fourth Crusade?Crusaders lost the support of people in Jerusalem and tried to regain public support.
Seljuks lost control of their Holy Land settlements and tried to take them back.
Seljuks won control of Jerusalem, and the pope asked crusaders to take back control.
Crusaders won control of Holy Land trade routes, and Seljuks tried to take them back.

Answers

Answer: C. Seljuks won’t control of Jerusalem, and the pope asked crusaders to take back control.

Step by Step Explanation: In 1187, Seljuks leader Saladin took control of the city of Jerusalem which lead to the Third Crusade. Pope Innocent III called on crusader to claim Jerusalem back.

Hope this helps! :)

Answer:

Answer C: Seljuks won control of Jerusalem, and the pope asked crusaders to take back control.

Explanation:

the Seljuks were given control over Jerusalem, but the city was open to unarmed Christian pilgrims and merchants.

In 1202, Pope Innocent III called on crusaders to claim Jerusalem for Christians.

This led to the Fourth Crusade.

Plz HELP FAST
What is one way that the Catholic Church was involved in government?

The pope became king of some kingdoms.
The pope was the Holy Roman emperor.
Bishops were responsible for elections.
Bishops were loyal to monarchs.

Answers

Answer:

Bishops were loyal to monarchs.

Answer:

the answer is D

"Leave your land, your relatives, and your father's home. Go to the land that I will show you." Who followed this quote to begin a new religion?

Answers

the answer is Abraham, the father of Isaac and Jacob

Answer:

The answer would be Abraham

Explanation:

Since he told the people to leave their homes just as the lord had told him.

What natural resource is found in all four (4) regions?​

Answers

Answer:

The four natural resources are renewable, living, non renewable, and fossil fuels. They are very important to our life and existance. Renewable resorces is something that can be renewed.

As im not sure which reasons you're talking about this is the best i can give you :/ hope i helped

________ united the Greek states after the Peloponnesian War.
a.
Chaeronea
c.
Philip II
b.
Alexander the Great
d.
Hellenist


Please select the best answer from the choices provided

A
B
C
D

Answers

It would be C. Philip ll

Answer:

C

Explanation:

Which statement best completes the diagram?

Answers

Answer:

the is c iI think i don't if im right

NEED HELP ASAP

In Common Sense, Thomas Paine argued that
A. America should be an independent nation.
B. America should reconcile with Britain.
C. America should submit to British regulations.
D. America should have its own monarchy.

Answers

Answer:

A

Explanation:

he explained in it that Americans should have independence from Great Britain

Thomas Paine advocated in Common Sense that America should be an independent nation. Option A is correct.

What role did Thomas Paine's Common Sense play in promoting American independence?

Common Sense established a strong argument for independence and took on the economic, political, and intellectual barriers to obtaining it. “Common Sense,” primitively published anonymously, campaigned for American colonies' independence from Britain and is regarded as one of the most influential pamphlets in American history.

Paine maintained that British control was to blame for practically every problem in colonial society, and that the 1770s crisis could only be remedied by colonial independence.

Paine's booklet, by advocating the idea of American exceptionalism and the necessity for a new nation to realize its promise, not only drew public support for the Revolution, but also put the rebellion's leaders under pressure to proclaim independence.

Therefore, option A is correct.

Learn more about the Thomas Paine, refer to:

https://brainly.com/question/5953344

#SPJ6

Other Questions
A student records a physical property of a rock as 2.2N. Which physical property has the student measured? What does Beowulf foresee concerning Freawarus marriage Carbon decays every 5700 years. If you found a rock containing Carbon that has gone through 2.5 half lives, how old is that rock? Love after Love By Derek Walcott What are machines fueled by?1. Energy 2. Electricity only3. gasoline only4. Sun You measure containers for international shipments. The height of the standard container is 6 feet and 7 inches. What is the height in meters? TIME REMAINING52:45The robotic rover Curiosity has instruments that detect radiation both inside the spacecraft and in the Mars environment. What is most likely the purpose of this radiation detection?to determine whether human exploration of Mars is possibleto develop better X-ray technologyto find evidence of once-living Martian microorganismsto investigate evidence of hydrogen and water (1/3)^2=? I need help with math I'm failing, because of my teacher By finding out who Figaro's parents are how does this inconvenience the Count? Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Steam Workshop Downloader