Feedback always occurs when

Answers

Answer 1

Answer:

you are really bored and you want to see some pretty interesting things

Explanation:


Related Questions

Explain what is diffusion and osmosis? Why are they Important to the cell? Explain one example of active transport in the cell. Write a paragraph (5-7 sentences).


-if you help I really appreciate you!

Answers

Answer:

Diffusion and osmosis are both passive transport processes that act to equalize the concentration of a solution. In diffusion, particles move from an area of higher concentration to one of lower concentration until equilibrium is reached. Significance of Diffusion and Osmosis Both diffusion and osmosis are really important as these ensure the equalization of forces inside cells and also inside an organism as a whole by spreading all the necessary chemicals and nutrients from highly concentrated area to the low concentration area inside an organism. The intake of water in plants is an example of osmosis. Diffusion is observed when a drop of food coloring is added to a glass of water, where eventually, the entire water content becomes colored.

Brainliest please!

what are 2 characteristics of s waves

Answers

Explanation:

s waves are shear waves. they move by material flexing or deformity sideways from the direction of waves travel

Which of the following is an example of predation?

Organism A benefits, Organism B is unaffected

Organism A benefits, Organism B benefits

Organism A benefits, Organism B is harmed

Organism A is unaffected. Organism B is unaffected​

Answers

Organism A benefits, Organism B is harmed.

The evolutionary species concept defines a species as: A. a group of populations that have shared a past and will have a shared future B. reproductively isolated populations C. smallest monophyletic taxa D. morphologically similar populations

Answers

Answer:

The correct option is A.

group of populations that have shared a past and will have a shared future

Explanation:

This is because evolutionary species concept is a concept that indicate a form of ancestry descendants or lineage of populations that descend from the same ancestors possessing similar characteristics which were inherited from the ancestry and these traits are evident in the future.

Select the statement which best describes the characteristics a baby raccoon will inherit from a parent. (2 points)
zennie / iStock 2018
A striped tail, black fur across its eyes, and sharp claws
Brown fur and the ability to search for food in groups
Four legs and the need to hibernate when the weather is cold
Webbed feet with claws and fur, and white fur on its eyes

Answers

Answer:

they furry

Explanation:

link to answer is here

Answer:

A striped tail, black fur across its eyes, and sharp claws

Explanation:

got it right on my quiz

Read the statement

An elephant is walking on the hot African plains in search of food. As it does so, its body temperature increases. As it walks, it comes across a small pond.

What should this elephant do to BEST maintain homeostasis?

Select one:

A. It should jump into the pond to cool off.

B. It should use its trunk to take a drink.

C. It should flap its ears to create a breeze.

D.It should move at a slower pace to conserve energy.

Thanks for helping me!

Answers

Answer:

I think it would be "B".

Explanation:

if the elephant is by a pond it would most likely drink the water to stay cool.

In an energy pyramid, the bottom level represents...

A. consumers

B. producers

C. scavengers

D. decomposers

Answers

Answer: B. Producers

Explanation:

Answer:

B. producers

Explanation:

i'm pretty sure because i've had it on a test before and decomposers are off to the side, but producers are on the bottom. it could possibly be decomposers based on which charts you use since some put decomposers on the bottom, but most are producers

which phase of cell division is shown?

Answers

Answer:

cell division is shown in anaphase

Help me with the vital signs and diagnostic signs and past medical history and patient history what is the answer for them according to the case pls help Help pls need it fast

Answers

Answer:

No.

Explanation:

Which phase describes "movement around each other" on a molecular level?
A) Solid
B) Gas
C) Liquid
D) Methane

Answers

Answer: I think it is liquid

Explanation:


PLEASE HELP !! ILL GIVE BRAINLIEST *EXTRA 40 POINTS* DONT SKIP :(( .!

Answers

Answer:

C

Explanation:

Animals that don't adapt to their new environment die

A woman with type A blood is claiming that a man with type AB blood is the father of her child, who is type B.
Can this man be the father of her child?
O A No
O B. Cannot be determined
0 C Yes



SAMMAAA PLZZZZ

Answers

Answer:

ITS CCCCCCCCCCCCC CCCCCCC

Answer:

Yes

Explanation:

Because he is AB so if his child is B he would take that dna from him but it could go either way

The animal that eats another is known as

Answers

Answer:

A predator

Step by step explanation:

Answer:

Carnivore or predator

Explanation:

Carnivores are animals that eat other animals. The word carnivore is derived from Latin and means “meat eater.”

Hope it helps u and sorry if it doesn't

PLEASE HELP !! ILL GIVE 40 POINTS ; PLUS BRAINLIEST !! DONT SKIP ANSWER.

Answers

Answer:

C c is the answer to your question

Answer:

chemical, because a new gas was formed

Explanation:

my tutor answered the question for me haha! hope i helped.

The base of all ocean food chains are formed by

Answers

Answer:

Phytoplankton

Explanation:


Why do scientists believe that some tectonic plates are moving away from each other?

Answers

The continents do move as new material from the center of the Earth rises, hardens and pushes older pieces of the Earth away from each other. They called their theory “sea floor spreading.” The theory explains that as the sea floor spreads, the tectonic plates are pushed and pulled in different directions

help pleasee!! A fern plant is growing in the forest by Scott's house. The leaves of the fern plant are small and green. Scott often finds small caterpillars eating the leaves of the fern plant. Which of the following is an inherited characteristic of the fern plant? No links!!

A. The shape of the fern plant’s leaves.
B. The location of the fern plant inside the forest.
C. The distance of the fern plant from Scott’s house.
D. The number of leaves that are eaten by caterpillars.

Answers

Answer:

Can't be B

Can't be C

Can't be D

The correct answer should be A!

Hope this helps.

If an organism has six pairs of chromosomes how many chromosomes will be in one cell produced by meiosis?

Answers

Answer: 23

Explanation:

What happens when a continental plate and a oceanic plate converge and why? Choose one.

(no links please)

a. The continental plate goes under the oceanic plate (subducts) because the continental plate is
thinner than the oceanic plate.

b. The continental plate subducts under the oceanic plate because the continental plate is thinner
than the oceanic plate.

c. The oceanic plate subducts under the continental plate because the oceanic plate is lighter than the continental plate.

d. None of these

e. The oceanic plate subducts under the continental plate because though the oceanic plate is
thinner than the continental plate, it is more dense.

pleaseee helpppp
will mark brainliest :)

Answers

Answer: i think it's e

Explanation: When an oceanic plate converges with a continental plate, the oceanic crust will always subduct under the continental crust; this is because oceanic crust is naturally denser.

(blank) measures how much space matter takes up.

Answers

Answer:

volume

Explanation:

it's volume I think

What are five decomposers that are found in or around Pride Rock in the movie Lion King

Answers

Answer:

Vultures, Hyenas, Ants, Bacteria that's all i got really

Explanation:

All of these either eat remains or break down remains of a decomposing animal and in doing so, speed up the process of the decomposing.

The five decomposers that are found in or around Pride Rock in the movie Lion King are Vultures, Hyena, Ants, and bacteria.

What is the movie Lion King?

The movie Lion King is directed by Jon Favreau, and written by Jeff Nathanson. This is an animated movie by Walt Disney in 2019.

This is a story of lion and his son Simba, the lion died and then Simba will take revenge for the death of his father, Mufasa.

Thus, the five decomposers that are found in or around Pride Rock in the movie Lion King are Vultures, Hyena, Ants, and bacteria.

Learn more about the movie Lion King

https://brainly.com/question/10390364

#SPJ2

the gas made by respiratin is called what​

Answers

carbon dioxide.

a gas produced by animals during respiration that plants use to make food, water, and oxygen.

hope this helps :)

What can HIV become? (write it out)

Answers

HIV came become AIDS (acquired immunodeficiency syndrome) if not treated.

Which type of weather do anticyclones bring?

Answers

Answer:

i think anticyclone weather bring us lots of cold weather and snow

Answer:

Anti cyclone bring us very cold, crisp bright winter days and warm sunny summer weather.

Explanation:

What happens when a person of blood type B receives blood type A?

Answers

Answer:

the white blood cells in your body would attack, in this case blood type A blood cells.

Explanation:

this happens because your body believes that the opposing blood type is bacteria, and is trying it kill you

The gulf flounder is a fish that is found in the Gulf of Mexico. It
migrates between estuaries and the open ocean. It prefers to live
in water with > 2% salinity, though can tolerate a wide range of
salinity, from 0.5% to 4%.
Choose the correct statement about the gulf flounder.
The gulf flounder is stenohaline.
The gulf flounder prefers to live in freshwater over saline water.
The gulf flounder possesses the ability to prevent the intake of
excess salt.
The gulf founder is not found in brackish water.

Answers

Answer: the gulf flounder possesses the ability to prevent the intake of excess salt

Explanation:

I did the tutorial

The graphs below show the population size of Organism A in a local lake, and the average temperatures of the lake by month.

Answer choices:

A) June
B) May
C) August
D) July

Answers

Answer:

its B

Explanation:

dont ask be i just know, and i got a good grade for that work even though i was hard

Answer:

July

Explanation:

1.) The optimal temperature for the Organism A population is approximately 25°C.

2.) The month during which the average temperature of the lake is around 25°C is July.

3.) The correct answer is: July

AG CLASS!!!!!!!!!!!

Which of the following schools offers undergraduates a five-week summer program in Kyoto, Japan, that allows students to study the public gardens of the city?


Purdue University

University of Tennessee

University of California at Berkeley

University of Oregon

Answers

University of Oregon I believe !

Answer:

University of California at Berkeley


What is the main difference between protons and neutrons?

Answers

Protons are positively charged (+) and neutrons have no charge

Answer:

Proton has a positive charge

Neutron has a negative charge

Explanation:

proton is a subatomic particle with a positive charge and they are bounded together in an atom's nucleus which results to a strong nuclear force.

Neuron is a subatomic particle with no charge, they are neutral and a neutral atom must have an equal number of protons a d electrons



PLZ HELP ILL MARK A BRAINIEST 10 Pts
Blood type analysis is used frequently as evidence in paternity suits. Consider the following
hypothetical cases presented in the table. The blood type of the mother and child are given; indicate which
blood type(s) MUST be the father's for each situation.

Answers

Answer:

Row 1: Any blood type except AB

Row 2: Blood type A/AB

Row 3: Any blood type except AB

Row 4: Any blood type

Row 5: AB/B

Explanation:

1. If the blood type was AB for the first one (two dominant alleles) then O could not appear as it is recessive.

2. The blood type must contain at least one A allele as AB is obtained from I^A and I^B (already provided by the mother).

3. Once again, the blood type must carry at least one recessive O allele for the O blood type to occur in this child.

4. As long as the blood type either carries a recessive O or another B, the blood type will result in a B.

5. The blood type of the father must contain at least one B for the child to have a B blood type.

Other Questions
Sort the cultural values and beliefs about women into the appropriate categories. Decide whether each was commonbefore or after changes in the late 1800s. Pls help. I will give you 10 points! Can somebody help me asap pls help me i will give 30 points help me pls don't type random letter or I will report u ty 1. Vamos a hacer un picnic en el parque hoy.A. lllgicoB. Lgico2. El primer da del ao es un da festivo, pero ese da casi todo el mundo est cansado! A. lllgicoB. Lgico3. La familia de Migdalia es enorme. Tiene parientes en casi todo el Mxico.A. lllgicoB. Lgico4. El beb de Sofa cumpli ayer 29 aos. Es muy simptico! A. lllgicoB. Lgico5. Muchos bebs tienen la costumbre de llorar cuando tienen hambre.A. lllgicoB. Lgico6. Qu desastre! Ayer fue el cumpleaos de Julio Andrs y se me olvid felicitarlo!A. lllgicoB. Lgico7. Una persona educada es una persona que no tiene buenos modales. A. lllgicoB. Lgico8. La fiesta de sorpresa para la Srta. Gutirrez fue excelente. Ella nos ayud a prepararla!A. lllgicoB. Lgico9. La abuelita de mi amiga Idalia naci hace dos das.A. lllgicoB. Lgico10. Alrededor del museo haba estatuas antiguas y modernasA. lllgicoB. LgicoHelp please Suzie looked at the diagram at right and wrote 134%=134/200. Is she correct? It is important to consider the social, emotional, physical, and economic effects of teen pregnancy on the teen parent, the child, the family, and society. Think about your goals for the future and how they could be affected by teen pregnancy. Use this decision-making process document to help brainstorm your ideas and organize your thoughts. Then respond to the prompt. the half-life of roentgenium -281 is 17 seconds,if 10 grams are left after 85 seconds,how many grams were initially in the original sample? Find the midpoint of the line segment with endpoints (-3, 2) and (1.-2)A)(-1,0)B)(0, -1)(-2,0)D)(0, -2) The radius of a circle is 11 millimeters. What is the circle's circumference? Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG The Know-Nothing Party opposed which of the following? 1) What is your Dawn Wall and how are you approaching it? What is the expected outcome? (Or, reflect on a 'Dawn Wall' in your past and discuss how you overcame it.)2) Describe a few things that Kevin and Tommy had to overcome to realize their goal. (Or, describe what things had to be in order or exist for their goal to be realized.) Which of the following ions is formed when a base is dissolved in a solution? H+ O OH SO42+ 1) What percentage of oxygen and carbondioxide inhaled and Exhaled Air ? .. A. Suriin kung anong panghalip panao na ginagamit sa pangungusap.1. Sila ay magsisimba.2. Hiniwa niya ang tiyan ng manok.3. Ako ay mag-aaral sa Tiptip ng Elementarya.4. Ikaw ay kasama ko. why is this wrong and what is the right answer? Which statement describes Keplers third law of orbital motion? Which of the following is the definition of geometric sequence?A. an ordered set of numbersB. an element in a sequenceC. a sequence in which terms are given by multiplying the previous term by a common ratioD. a sequence in which terms are not given by multiplying the previous term by a common ratio Steam Workshop Downloader