Find the amino acid chain that forms from the mRNA sequence DNA
sequence below.
GATCGATACCATTCGGCGCATACTTCG

Answers

Answer 1

Answer:

mRNA= CUA GCU AUG GUA AGC CGC GUA UGA AGC

Amino acid chain=LEU ALA MET VAL SER ARG VAL STOP SER

Explanation:

Find the START codon (AUG). Start reading in groups of 3 and check against a codon table. When you get to a STOP (UAA, UAG, UGA) you’ve got that protein strand’s sequence.


Related Questions

what is the tidal range if the water measures 2 feet at high tide and -1 foot at low tide

Answers

High tide & low tide are separated by the tidal range. A tidal range of 3 feet as a result.

In marine biology, what is tidal range?

Definition. A tidal cycle's vertical height difference between successive low and high waters is known as the tide range. Across different places and throughout various time intervals, the tide's range varies (Stembridge, 1982).

What kind of tidal ranges exist?

The largest tidal range in the world, at 16.3 meters (53.5 feet), is experienced in the Bay of Fundy in Canada. A similar range is also present in Ungava Bay, also in Canada. As in Bristol Channel between Wales and England in the United Kingdom, tidal ranges of up to 15 meters (49 feet) are frequently experienced.

To know more about tidal ranges visit:

https://brainly.com/question/937528

#SPJ9

grasses when comapred to legumes are typically lower in calcium true false greatest amount of water when oxidized

Answers

Grasses when compared to legumes are typically lower in calcium. So the statement is true.

Grasses are typically lower in calcium when compared to legumes. Legumes are known for their ability to fix nitrogen in the soil, which means they can produce their own source of nitrogen. As a result, they can afford to invest more in the production of calcium-rich structures such as seeds, leaves, and stems. In contrast, grasses are not able to fix nitrogen as effectively, so they rely more on the soil for their nitrogen needs, this often means they have less calcium available to them, resulting in lower levels of calcium in their tissues compared to legumes.

Learn more about calcium: https://brainly.com/question/26636816

#SPJ11

In a mutualistic relationship, only predatory organisms benefit. True/False

Answers

Answer: False - both organisms work together to help each other

Answer:

false

Explanation:

what is the main difference between traditional alkaline lysis method and the kit method of isolating dna specifically in regards to collecting the dna in the last few steps?

Answers

Answer:

The main difference between the traditional alkaline lysis method and the kit method of isolating DNA is the way DNA is collected in the last few steps. In the traditional alkaline lysis method, DNA is collected by ethanol precipitation, where the DNA is pelleted by centrifugation and washed with ethanol to remove any contaminants. On the other hand, in the kit method, DNA is collected by binding the DNA to a silica column, washing away contaminants, and then eluting the purified DNA from the column. The kit method is more efficient and less time-consuming than the traditional method and yields high-quality DNA suitable for downstream applications.

what are the advantages of having transcription factors to help control transcription, rather than rna polymerase alone?

Answers

Transcription is the process in which an RNA is synthesized from a strand of DNA. Transcription factors are proteins that bind to DNA in promoter regions near genes and regulate transcription by activating or repressing RNA polymerase activity.

One of the main advantages of having transcription factors is that they allow more precise regulation of gene expression. Another advantage of having transcription factors is that they allow a rapid response to environmental stimuli or cellular signals.

Transcription factors are essential for precise and adaptive regulation of transcription. By enabling a rapid response to changes in the environment and cell signaling, they help ensure that genes are expressed at the right time, in the right place, and in the right amounts.

In conclusion, the presence of transcription factors allows for fine regulation of gene expression and rapid response to changing conditions in the environment and within the cell.

Lear More About Transcription factors

https://brainly.com/question/29056552

#SPJ11

what is the process by which solutes are transferred to the tubular fluid from the peritubular soace

Answers

The process by which solutes are transferred to the tubular fluid from the peritubular space is called tubular reabsorption.

What is tubular reabsorption? Tubular reabsorption is the process by which solutes such as ions, water, and nutrients are reabsorbed into the bloodstream from the tubular fluid. This process happens in the renal tubules and collecting ducts of the nephron.

The reabsorption of essential solutes is regulated by hormones such as aldosterone, antidiuretic hormone, and parathyroid hormone. The peritubular space, located between the tubular epithelium and the capillaries, is where the reabsorption of substances takes place.

This region of the kidney contains blood vessels that help with the reabsorption of solutes. Reabsorption is an essential function of the kidney that allows it to conserve the body's valuable solutes while also excreting waste products.

To know more about tubular reabsorption, refer here:

https://brainly.com/question/29684635#

#SPJ11

there are very few difference between treating domesticated animals like dogs and cats and treating exotic animals. question 8 options: true false

Answers

Answer:

False.

Explanation:

Exotic animals have specialized needs different from domesticated animals like cats and dogs.

Most of the moths in a pre-industrialized area were white. Industrialization caused an increase in air pollution. The pollution blackened the surface of rocks and tree trunks. About 100 years later, most of the moths in that area were black. This change in moth color is an example of what?

Answers

The change in moth color from white to black in response to industrialization and increased air pollution is an example of industrial melanism.

glycolysis is an anaerobic process, indicating that the glycolytic reactions a.produce citric acid. b.produce atp. c.require no oxygen. d.produce molecular oxygen

Answers

Glycolysis is an anaerobic process, indicating that the glycolytic reactions require no oxygen. The correct option is c.

What is glycolysis?

Glycolysis is the process of breaking down glucose into two molecules of pyruvate. It occurs in the cytoplasm of all living cells and is an anaerobic process, which means it does not require oxygen.The following are the main features of glycolysis:It is the initial stage of cellular respiration in the cytoplasm. It's a ten-step process that turns one molecule of glucose into two molecules of pyruvate.In an anaerobic environment, it occurs without oxygen.Glycolysis is a universal pathway that occurs in both aerobic and anaerobic organisms because it occurs in the cytoplasm and does not require oxygen.Glycolysis has a net gain of two ATP molecules and produces NADH and pyruvate molecules.ATP and NADH are produced as a result of this.

Answer: The glycolytic reactions require no oxygen.

Here you can learn more about anaerobic process

https://brainly.com/question/7829844#

#SPJ11

what is cell wall? breaf explain ​

Answers

Answer:

The cell wall is a rigid, protective layer that surrounds the cells of plants, fungi, bacteria, and some protists. It is located outside of the cell membrane and provides structural support and protection for the cell. The cell wall is made up of different components depending on the type of organism, but it typically contains cellulose in plants, chitin in fungi, and peptidoglycan in bacteria. The cell wall also helps regulate the movement of water and other substances in and out of the cell.

Explanation:

Answer:

A cell wall forms the outer covering of a cell

describe the function of these terms and describe where they are located: main bronchus, trachea, alveoli, and acinus.

Answers

The main bronchus is the main airway that branches off the trachea and leads to the lungs. The trachea is the tube that connects the throat to the lungs and allows air to enter and exit the body. The alveoli are microscopic sacs located in the lungs The acinus is the cluster of alveoli located at the end of the bronchi and bronchioles.

The trachea, also known as the windpipe, is a tube made of cartilage rings and smooth muscle that connects the larynx to the bronchi. The trachea is located in the throat, extending from the larynx down to the bronchi in the chest. Its primary function is to provide an air passage between the throat and the lungs.

The main bronchus is a cartilaginous tube that is the first branch of the trachea. The right main bronchus is larger and straighter than the left main bronchus, which is more angled to accommodate the position of the heart. Its function is to conduct air into the lungs, branching off into smaller bronchi and ultimately ending in the alveoli.

The alveoli are tiny air sacs located in the lungs that are responsible for gas exchange. They are located at the end of the bronchioles and are surrounded by capillaries, which allow oxygen and carbon dioxide to pass between the air sacs and the bloodstream.

Their function is to provide a large surface area for the exchange of gases, which is essential for respiration.The acinus is the functional unit of the lung, consisting of the alveoli, their associated capillaries, and the connective tissue between them.

It is where the exchange of oxygen and carbon dioxide between the air and blood takes place. The acinus is located in the lungs and is responsible for maintaining proper gas exchange.

Learn more about respiratory system here:

brainly.com/question/4190530

#SPJ11

the range of environmental temperatures in which a genotype can persist is one aspect of its . a. habitat b. niche c. behavior d. phylogeny e. i don't know the answer

Answers

The range of environmental temperatures in which a genotype can persist is one aspect of its niche (option b).

Ecology defines a niche as the compatibility of a species with a particular natural circumstance. It explains how an organism or population reacts to the distribution of resources and rivals (for instance, by expanding when resources are abundant and shrinking when predators, parasites, and pathogens are scarce), as well as how it changes those same variables. (for example, limiting access to resources by other organisms, acting as a food source for predators and a consumer of prey).

"The type and number of variables that make up an environmental niche's dimensions vary from one species to another [and] the relative importance of specific environmental variables for a species may vary according to the geographic and biotic contexts," according to the study.

A niche refers to the specific role an organism plays in its ecosystem, including its interactions with other species and its preferred environmental conditions.

For more such questions on niche , Visit:

https://brainly.com/question/728057

#SPJ11

(T/F) only a portion of dna, called a gene, is copied into rna at one time.

Answers

only a portion of DNA, called a gene, is copied into rna at one time is true.

Transcription is the process through which a small section of DNA, known as a gene, is converted into RNA all at once. Specific regulatory sequences and transcription factors that bind to the DNA and start transcription of the gene decide which portion of the DNA is transcribed into RNA. The resulting RNA molecule is complementary to the transcribed DNA segment and contains genetic data that can be converted into a protein through the process of translation.

Thus a part of region encoding for a protein is copied from the DNA and the rest of the region remained un-transcribed.

TO know more about DNA click here

brainly.com/question/16099437

#SPJ4

By which of these are tiny dust particles removed from alveolar surfaces?

Answers

Tiny dust particles are removed from alveolar surfaces by a process called phagocytosis, which is carried out by specialized cells called alveolar macrophages.

White blood cells called alveolar macrophages are found in the lungs and are in charge of absorbing and digesting foreign substances including dust, germs, and other microbes.

Alveolar macrophages come into touch with dust particles as they enter the alveoli and quickly surround and cling to them. The particles are subsequently eaten or coughed up by the macrophages, which have moved the particles up towards the bigger airways of the respiratory system and out of the body.

This procedure aids in preventing dust and other particles from building up in the alveoli and harming or inflaming them, making it a crucial lung defense mechanism.

To know more about phagocytosis

brainly.com/question/11667538

#SPJ4

wo parts to this question: when you hear the terms chief cells, parietal cells and enteroendocrine cells, where are we in the body and what step in the digestive process are we involved with? your answer:

Answers

The terms chief cells, parietal cells, and enteroendocrine cells refer to specific cell types found in the stomach. These cells are involved in the digestive process of breaking down food.

Parietal cells are found in the lining of the stomach and are responsible for producing hydrochloric acid, which lowers the pH of the stomach and helps to break down food. Parietal cells also produce intrinsic factor, which is necessary for the absorption of vitamin B12.

Chief cells, also found in the stomach lining, produce and secrete pepsinogen, an inactive enzyme that is converted to the active enzyme pepsin in the presence of hydrochloric acid. Pepsin breaks down proteins into smaller peptides, aiding in the digestive process.

Enteroendocrine cells are scattered throughout the lining of the stomach and small intestine and produce various hormones that regulate digestion and appetite.

Chief cells, parietal cells, and enteroendocrine cells are all involved in the digestive process in the stomach. Parietal cells produce hydrochloric acid and intrinsic factors, chief cells produce pepsinogen, and enteroendocrine cells produce various hormones that regulate digestion and appetite.

To learn more about enteroendocrine cells

https://brainly.com/question/6709917

#SPJ4

which of these contain tissues? choose 2 answers: choose 2 answers: (choice a) cells a cells (choice b) organs b organs (choice c) organ systems c organ systems

Answers

The two options that contain tissues are (B) Organs and (C) Organ Systems.

The choice (A) Cells is incorrect because cells are the fundamental unit of life, and tissues are a group of cells that are specialized to carry out a specific function. Tissues are a group or layer of cells that work together to perform a specific function. Cells make up tissues.

An organ is a collection of tissues that work together to perform a specific function in the body.

An organ system is a group of organs that work together to carry out a specific function.

Therefore, the correct answer is (B) Organs and (C) Organ Systems.

To know more about tissues, refer here:

https://brainly.com/question/17664886#

#SPJ11

what would you expect to see if you plated some of your transformed bacteria onto a plate witgout antibiotic

Answers

You would expect to see the bacteria growing on the plate without antibiotic. This is because the bacteria has been transformed, and the transformation process gives it resistance to antibiotics. The bacteria would form colonies on the plate, showing a white or colored film, depending on the strain of bacteria.

Additionally, the colonies may be surrounded by a “halo” of inhibited growth, which is a result of the bacteria’s secretion of toxins or other metabolites into the environment that limit growth of surrounding bacteria.

In the case of antibiotic resistance, the bacteria is now capable of survival in the presence of the antibiotic, and the plate without antibiotic allows this to be observed.

Know more about antibiotic here:

https://brainly.com/question/10868637

#SPJ11

just need the answers

Answers

Answer:

See explanation.

Explanation:

1. brachialis

2. deltoid

3. extensor digitorum of hand

4. triceps brachii

5. infraspinatus

6. trapezius

7. latissimus dorsi

8. gluteus medius

9. gluteus maximus

10. biceps femoris (long head)

11. semitendinosus

12. gracilis

13. gastrocnemius (lateral head to be specific)

14. soleus

which primers should be used to amplify this segment of dna through pcr (select all that apply)? 5'-ctgacatgtacgtag-3' 3'-gactgtacatgcatc-5'

Answers

The primers that should be used to amplify this segment of DNA through PCR are 5'-CTGACATGTACGTAG-3' and 3'-GACTGTACATGCATC-5'. They will hybridize to the two ends of the target sequence, and by adding DNA polymerase, DNA synthesis can occur in a continuous cycle, amplifying the original sequence exponentially. These primers contain the nucleotide sequence of the target segment, and will form the perfect hybridization needed for PCR to work.

PCR (Polymerase Chain Reaction) is an essential tool for molecular biologists which allows for the amplification of a DNA sequence of interest. The process works by using two synthetic primers (short, single-stranded pieces of DNA) which are complimentary to the sequence of interest. The primers will hybridize to the two ends of the target sequence, and by adding DNA polymerase, DNA synthesis can occur in a continuous cycle, amplifying the original sequence exponentially.

For the PCR process to be successful, the primers must hybridize perfectly to the target sequence, so they must be designed carefully. For the sequence given in the question, the two primers needed are 5'-CTGACATGTACGTAG-3' and 3'-GACTGTACATGCATC-5'. These primers contain the nucleotide sequence of the target segment, and will form the perfect hybridization needed for PCR to work.

For more such questions on PCR (Polymerase Chain Reaction).

https://brainly.com/question/28502368#

#SPJ11

which of the following statements regarding ion channel regulation by gpcrs is false? activation of gpcrs in rod cells leads to increased neurotransmitter release.

Answers

Regarding ion channel regulation by GPCRs, the false statement is that activation of GPCRs in rod cells leads to increased neurotransmitter release.

Ion channels are tiny, complex proteins that are embedded in a cell's lipid membrane. These proteins allow ions such as sodium, potassium, and calcium to cross the membrane barrier and enter the cell's cytoplasm (and, in some cases, to leave the cytoplasm and exit the cell). GPCRs (G protein-coupled receptors) are a type of protein found in cell membranes that allow signals to be transmitted into a cell. In GPCR signaling, G proteins, which are a class of membrane-bound proteins that activate intracellular signaling pathways, are activated. G protein-coupled receptors (GPCRs) serve as a molecular switch, allowing extracellular signals such as hormones and neurotransmitters to regulate cell signaling. In the case of ion channels, GPCRs may activate or inhibit the channels.

As a result, changes in ion flow across the membrane of a cell, such as neurons, may occur. Some ion channels are directly activated by GPCRs, while others are indirectly activated or inhibited through second messenger pathways. Studies have found that activation of GPCRs in rod cells leads to the closure of ion channels and decreased neurotransmitter release, contrary .

Hence , This is due to the hyperpolarization of the rod cell's membrane potential, which inhibits neurotransmitter release.

To know more about neurotransmitter please visit :

https://brainly.com/question/840056

#SPJ11

gunter blobel and his colleagues proposed that the site of protein synthesis is determined by information contained in the n-terminal portion of the protein, the first part of emerge from the ribosome. what did they call the proposal

Answers

Amino acid sequences determine whether a protein will be built in the membrane or passed through the membrane to enter an organelle or leave the cell.

Gunter Blobel demonstrated in 1975 that some amino acids in a protein could be used as an address label to determine the location of a protein's delivery.

The signal hypothesis proposes that the initial sequence of amino acids used in the production of proteins for secretion, which involves the protein's movement across a biological membrane, may or may not be present in the mature protein.

Günter Blobel and David Sabatini proposed the signal hypothesis in 1971, and Blobel and colleagues demonstrated it in 1975. The signal hypothesis shows that a signal sequence directs cytoplasmically synthesized proteins to the ER membrane.

To learn more about membranes here

https://brainly.com/question/26872631

#SPJ4

where can you find nature preserves with komodo dragons in north america? select the grammatical subject of the sentence above:

Answers

The grammatical subject of the sentence above is "you."

The sentence "Where can you find nature preserves with Komodo dragons in North America?" is a question. It asks for particular information regarding the nature preserves in North America.

The sentence contains two clauses: the main clause and the subordinate clause.

The main clause of the sentence is "Where can you find nature preserves in North America?" and the subordinate clause is "with Komodo dragons." In the sentence, the word "you" is used as a subject that is acting to find nature preserves with Komodo dragons.

Hence, 'you' is the grammatical subject of the sentence.

Learn more about the grammatical subject:

https://brainly.com/question/28629972

#SPJ11

What does upwelling mean, what is the definition?

Answers

This is a big question and it is also important for climate studies and I am only going to answer it in simple terms but let’s not forget there are quantitative answers at global scales.

When the wind blows onshore it moves the surface water towards the shore. If the shore is a wall like a harbour wall then the moving surface water raises the water level at the wall. This raised water level at the wall puts pressure on the deeper water below (which moves away from the base of the wall to regions of lower pressure or away from the wall at the bottom). The water at the wall moves downward to compensate and this is called downwelling. More surface wind (stress) and more downwelling.

When the wind blows off shore. The surface water moves away from the wall. Sea level falls at the wall and water rises up the wall from the bottom. This is called upwelling.

Ekman worked out that in the open ocean the transport of surface water moves to the right of the wind direction due to the effects of the Earth’s rotation (in the northern hemisphere). So when the wind is parallel to a shore there will be upwelling or downwelling depending on the wind direction. Imagine a straight shoreline aligned towards the south (or north). If the wind blows to the south (from the north or a north wind) then the surface water moves offshore to the right of the wind and upwelling occurs.

These upwelling regions bring up cooler water rich in inorganic nutrients and surface phytoplankton growth is increased. This happens particularly seasonally off West Africa and Venezuela. There is also Equatorial Upwelling with zonal wind so some corals won’t die out so quickly with global warming.

if a hox 13 gene in a mouse was replaced with a hox 1 gene, how might this alter animal development?

Answers

Replacing the Hox 13 gene with the Hox 1 gene in a mouse affects the body pattern of the animal.

The Hox family of genes plays a key role in regulating the body patterning of animals. Hox 13 is a gene in the Hox gene family that helps to regulate the axial patterning of the animal, while Hox 1 is a gene that helps to regulate the development of the head and neck. Replacing Hox 13 with Hox 1 could lead to the alteration of the body patterning of the animal, resulting in an altered morphology of the animal's body.

For example, the replacement of Hox 13 with Hox 1 could cause the animal to develop additional heads or other body parts in the wrong places. Additionally, the replacement could alter the overall body shape and size, potentially leading to malformations.

Other effects might include changes in the types and amounts of skin pigment, and changes in skeletal, cardiac, and organ development. All of these changes could have significant impacts on the health and well-being of the animal.


In conclusion, replacing the Hox 13 gene with the Hox 1 gene in a mouse could have significant effects on animal development, resulting in altered body patterning, changes in the type and amount of skin pigment, and potential malformations in other body parts.

To know more about Hox 13 gene, refer here:

https://brainly.com/question/15647992#

#SPJ4

what is the risk for a man with a 47,xyy karyotype to produce a child with a 47,xyy karyotype? a. 0% b. 50% c. 100% d. 25%

Answers

The risk for a man with a 47,xyy karyotype to produce a child with a 47,xyy karyotype is 0%.

A karyotype is a visual portrayal of the chromosomes. A karyotype, as seen under a light microscope, allows one to see the number, size, and shape of the chromosomes. The human karyotype typically consists of 23 pairs of chromosomes, including 22 pairs of autosomes and one pair of sex chromosomes (XX or XY). Chromosomes are classified based on the location of the centromere and the relative length of the arms. Karyotypes can be used to detect chromosomal abnormalities, such as Down syndrome, Turner syndrome, and Klinefelter syndrome.A male with a 47, XYY karyotype has an extra Y chromosome. The condition is known as Jacob's syndrome or XYY syndrome. It typically occurs in 1 out of every 1000 male births.

Children with XYY syndrome have a height that is somewhat above average. Their intellectual and behavioral functioning is generally within the average range, although they may have mild language, learning, or motor difficulties. Increased violence or criminal behavior are not related to the XYY condition. There is no such risk for a man with a 47, XYY karyotype to produce a child with a 47, XYY karyotype. So, the correct answer is 0%.

To know more about Karyotype please visit :

https://brainly.com/question/3852730

#SPJ11

which muscle group controls the knee from the end of the loading response to midstance (i.e. from 15 degrees of flexion to 0 degrees of flexion)?

Answers

The muscle group that controls the knee from the end of the loading response to midstance (i.e., from 15 degrees of flexion to 0 degrees of flexion) is the quadriceps muscle group. They are responsible for extending the knee joint and straightening the leg.

Anatomically, the quadriceps femoris consists of four different muscles: the rectus femoris, vastus intermedius, vastus medialis, and vastus lateralis. Together, these four muscles form the large muscle mass that extends from the hip to the knee joint.

The quadriceps muscle group is important for activities like walking, running, jumping, and squatting. During the loading response to the midstance phase of gait, the quadriceps work to control the knee joint as the leg absorbs impact forces and transitions from a bent to a straight position.

Learn more about the quadriceps muscle group:

https://brainly.com/question/28812050

#SPJ11

describe how a serial dilution, if performed incorrectly, can lead to a gross systematic error in a spectrophotometric analysis.

Answers

In a spectrophotometric analysis, a gross systematic error can occur if the serial dilution is not performed accurately.

For example, if the dilution factor is not consistent or if the volume of the diluent added to each sample varies, it can lead to an error in the measured absorbance values.

A serial dilution is a procedure in which a substance is diluted multiple times to achieve the desired concentration. Incorrect execution of serial dilution can lead to a significant systematic error in spectrophotometric analysis.

The use of a standard curve in the spectrophotometric analysis is standard. The concentration of the unknown sample can be calculated based on the curve of known concentrations of the standard. The use of a known standard concentration in serial dilution is the first step.

This step ensures that the concentration of the unknown sample is correctly identified. An error in the serial dilution concentration can be a major cause of the systematic error. Scientists employ spectrophotometric analysis to quantify the concentration of an unknown sample. The error in the standard dilution concentration could, however, lead to a measurement mistake.

A serial dilution error can cause an incorrect result even if the spectrophotometer is correctly calibrated or operating accurately. The effect of a gross systematic error on the accuracy of spectrophotometric analysis is substantial. Gross and systematic errors can result in incorrect outcomes that can have serious implications.

A systematic error can be identified by measuring the deviation of the results from the theoretical value. A thorough check of serial dilution accuracy, on the other hand, can prevent this mistake.

Learn more about serial dilution:

https://brainly.com/question/30907315

#SPJ11

What is the average for the following set of measurements?
7.1 g, 9.8 g, 2.3 g, 8.5 g, 7.4 g, 5.7 g
A. 9.8 g
B. 6.8 g
C. 8.2 g
• D. 40.8 g

Answers

Answer:

6.8g

Explanation:

All numbers are added together and you divide the total but the amount of numbers given.

All numbers added equals to 40.8

Numbers given equals 6

40.8 divided by 6 equals 6.8

Mass of crucible = l0g
Mass of crucible and soil before heating = 28g
Mass of crucible and soil after heating = 18g.
Determine the percentage of water in the given soil sample.

Thank you!​

Answers

Answer:

Mass of soil = (mass of crucible and soil after heating) - (mass of crucible) = 18g - 10g = 8g

Mass of water in soil = (mass of crucible and soil before heating) - (mass of crucible and soil after heating) = 28g - 18g = 10g

Percentage of water in soil = (mass of water in soil / mass of soil) x 100%

= (10g / 8g) x 100%

= 125%

Therefore, the percentage of water in the given soil sample is 125%. However, it is not possible to have more than 100% of a substance in a mixture. This result may indicate that there was an error in the measurements or calculations.

Answer:

Explanation:

To determine the percentage of water in the soil sample, we need to find the mass of water lost during heating.


Mass of water lost = Mass of crucible and soil before heating - Mass of crucible and soil after heating

= 28g - 18g

= 10g


Now, we can calculate the percentage of water in the soil sample.


Percentage of water = (Mass of water lost / Mass of crucible and soil before heating) * 100

= (10g / 28g) * 100

= 35.71%


Therefore, the percentage of water in the given soil sample is approximately 35.71%.


hope it helps!

What are the characteristics of protists

Answers

Protists are a diverse group of organisms that exhibit a wide range of forms, sizes, and modes of nutrition. They play important roles in many ecosystems and have contributed to the evolution of higher organisms.

What are the characteristics of protists?

Protists are a diverse group of eukaryotic organisms that are not plants, animals, or fungi. Some protists are unicellular, while others are multicellular. They exhibit a wide range of forms, sizes, and modes of nutrition.

Some protists are photosynthetic and produce their own food, while others are heterotrophic and consume other organisms or organic matter.

Here are some general characteristics of protists:

Eukaryotic cells: Protists are eukaryotic, which means their cells contain a nucleus and other membrane-bound organelles.

Diverse modes of nutrition: Protists can be autotrophic or heterotrophic. Autotrophic protists, such as algae, use photosynthesis to produce their own food. Heterotrophic protists, such as amoebas, consume other organisms or organic matter.

Unicellular or multicellular: Protists can be unicellular, such as protozoans, or multicellular, such as seaweeds.

Sexual or asexual reproduction: Protists reproduce both sexually and asexually, depending on the species.

Live in diverse habitats: Protists can be found in freshwater and marine environments, as well as in soil, and even in the digestive tracts of animals.

Some are symbiotic: Some protists form symbiotic relationships with other organisms, such as the protist Trichonympha living in the gut of termites, helping to break down cellulose in wood.

Learn more about protists at: https://brainly.com/question/2169979

#SPJ1

Other Questions
1. What is meant by "fruit of the poisonous tree"? 2. Define Locard's Exchange Principle. a marine biologist is preparing a deep-sea submersible for a dive. the sub stores breathing air under high pressure in a spherical air tank that measures 78.0 cm wide. the biologist estimates she will need 3700. l of air for the dive. calculate the pressure to which this volume of air must be compressed in order to fit into the air tank. write your answer in atmospheres. be sure your answer has the correct number of significant digits. please help find the slope of the line between the points Convert the mixed number below to an improper fraction 4 1/2 how did the democratic republican president and congress contribute to the expansion of the federal government How was Fitzgerald a perfect chronicler of his time? make your first point the origin. what does your second point have to be to get an output of 5 from the function? On board were 50 man with trinkets and treasures intanded for trading with the native peoples when they disembarked felix aspires to be an engineer working for the government. what credentials will felix require to apply for a post as a senior engineer in the government? Redaccin de un texto en el cual ejemplifique el uso correcto de las variaciones lxicas. PROOFS help needed badly will give many points as possible! 1.2.3.4.5.1.2.3.4.5.1.2.3.II Given: AD AB, AC bisects ZDABProve: AADC = AABC4.Statements1.Statements2.3.12 Given: JM NM, L is the midpoint of JNProve: AJLM ANLM4.1.2.3.4.5.1.2.3.4.5. which statement most accurately describes women who are involved in a situation of domestic violence? Select the correct answer from the drop-down menu.Native American nations in the United States areunder the authority of both the federal and state governmentsunder the authority of state governments but not the federal governmentindependent of both the federal and state governmentsunder the authority of the federal government but not state governments Out of 80 customers at an ice cream van, 48 had syrup, 28 had sprinkles and 16 had bothtoppings on their ice cream. Use a Venn diagram to find the probability that a randomlyselected customer doesn't have either topping, given that they don't have sprinkles.I know the answer is 20/52, I just cant work out how to get to that answer You deposit $5000 in an account earning 5% interest compounded continuously. How much will you have in the account in 5 years? Round to the nearest cent. Classify each pair of numbered angles as corresponding, alternate interior, alternate exterior, or none of these.Drag and drop the choices into the boxes to correctly complete the table.Put responses in the correct input to answer the question. Select a response, navigate to the desired input and insert the response. Responses can be selected and inserted using the space bar, enter key, left mouse button or touchpad. Responses can also be moved by dragging with a mouse.corresponding alternate interior alternate exterior none of these every week, maddie asks her parents to push back her curfew on friday night by one hour. her parents usually say no, but once in a while they give in and agree to let her stay out an hour later than usual. maddie will probably HOW THE NEED TO BELING INFLUENCERS HUMAN BEHAVIOR AND MOTIVATION by Kendra Cherry which parts of the composition of the starry night did vincent van gogh paint from his imagination or memory? what are the properties of the relation in which a college student is related to another iff the they have attended class together? you answered transitive you answered anti-symmetric you answered anti-reflexive correct! reflexive correct! symmetric Steam Workshop Downloader