How do cells maintain water balance through osmosis? (Choose 2)
If a salt water fish is placed in a fresh water aquarium, water will leave the fish's cells.
In the experiment, the only isotonic solution was the 10% salt water solution.
The egg swelled in distilled water because it is hypotonic to the egg's interior.
The concentration of solute is greater inside the egg than it is in the Kayro syrup.
The egg swells when placed in a hypertonic solution.

Answers

Answer 1

Answer:

The egg swelled in distilled water because it is hypotonic to the egg's interior.

Explanation:

That's one of them. Im sorry i dont know the other


Related Questions

How are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.

Answers

Answer:

I don't know

Explanation:

I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.

2 Both types of succession result in greater biodiversity over time.

3 Both types of succession decrease the stability of an ecosystem.

4 Both types of succession have the same starting conditions.

5 Both types of succession eventually lead to a community closer to equilibrium.

Hold on, our servers are swamped. Wait for your answer to fully load.

Describe one method to reduce the air pollutants released from a coal burning power plant

Answers

Answer:

A method to reduce the air pollutants released from a coal burning power plant is carbon capture.

Explanation:

Carbon Capture: It separates CO2 from emissions sources and recovers it in a concentrated stream. The CO2 can then be injected into the soil underground for permanent storage, or sequestration. Reuse and recycling can also reduce the environmental effects of coal production and use.

I don’t have a lot of time please help!
No websites or links.

Don’t answer it if you don’t now. Thanks

Answers

ANSWER: KR or Krypton has 36 protons

how we know that is because the atomic number of an element will ALWAYS be the same number of protons

for example if we have atomic number 79 for AU or gold then that tells you gold will have 79 protons

hope this makes since and helps :)

Which part of a DNA molecule is responsible for the direct coding of specific traits in an organism?

Answers

Answer:

i dont know i need points

Explanation:

Someone’s help me please

Answers

Answer:

trailmix

Explanation:

Which of the following factors would make the smallest contribution to determining the climate of an ecosystem?


a.
precipitation patterns


b.
ocean currents


c.
geographic features such as mountain ranges


d.
magma under the earth's crust

Answers

Answer:

Latitude. ...

Elevation. ...

Ocean Currents. ...

Topography. ...

Vegetation. ...

Prevailing winds.

REPLY ASAP what's the main function of red blood cells, white blood cells, platelet and plasma?

Answers

Answer:

carries the blood components throughout the body

Explanation:

plasma is the largest part of your blood.

Biodiversity
8
A farmer who owns a large fruit orchard has noticed that certain tree species in his orchard are failing to produce fruit and are slowly
dying. This has caused a decrease in the variety of fruit available for him to sell to consumers. Which of the following changes has
most likely caused this change in biodiversity?
OA
increased soil aeration due to an increase in earthworm populations
OB
decreased rainfall due to a prolonged period of drought
OC. decreased competition for space due to the removal of weeds
OD
increased pollination due to an increase in pollinator populations

Answers

Answer:

OA increased soil aeration due to an increase in earthworm populations.

Answer:

it is B. decreased rainfall due to a prolonged period of drought

Explanation:

trust me i got it right on my quiz

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Answers

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

Is this person male or female? Why? :l

Answers

Answer:

I think Female because hey aren't any Y chromosomes

hope this helps

have a good day :)

Explanation:

И a whole

The cell of
an elephant will be not be larger than that of an ant give reasons?​

Answers

The cell of an elephant will not be larger than the cell of an ant because the size of an animal cell is more or less the same in every animal cell. ... For example, the size of muscle cell and the size of nerve cell will differ from one another because of their function rather than the animals in which they are found.

Answer:

Explanation:

The cell of  an elephant will be not be larger than that of an ant.

This is because the shape and size of the cell does not depend on the body of the organism but on the function that the cell performs.

So the cell of the elephant will not be larger than that of an ant.

Hope it helps!

Please mark as brainliest!

PRODUCT
OR
11. (Circle one) Oxygen is a
released?)
REACTANT
of respiration? (In other words, is it needed or

Answers

Answer: ?

Explanation:

Nondisjunction that occurs during meiosis II produces what?

Answers

Answer:

Both of these daughter cells will then go on to divide once more in meiosis II, producing 4 daughter cells, 2 with n+1 and 2 with n-1. Nondisjunction in meiosis II results from the failure of the sister chromatids to separate during anaphase II.

how does rock turn into soil​

Answers

Erosion it breaks down the rocks into soil

Answer:

Rocks turn into soil through the process of weathering.

Explanation:

Weathering is when rocks are broken down into smaller pieces

Describe how the picture below represents the function of the immune system

Answers

Answer:

The Human Immune system helps fight bacteria and germs and viruses because without the Immune system we could die it is what protects us from The flu and sometimes cov id with a weak immune system we might no survive.

Explanation:

During a study session about evolution, one of your fellow students remarks "The giraffe stretched its neck while reaching for higher leaves, its offspring inherited longer necks as a result, which statement is most likely to be helpful in correcting this students misconception?

a) characteristics acquired during an organisms life are generally not passed on through genes
b) spontaneous mutations can result in the appearance of new traits
c) only favorable adaptations of survival value
d) disuse of an organ may lead to its eventual disappearance

Answers

Answer: Characteristics acquired during an organism's life are generally not passed on through genes.

Explanation:

The most common misconception between students which can be corrected is that the characteristics acquired during an organisms life are generally not passed on through the genes. Thus, the correct option is A.

What are acquired traits?

Acquired traits or characteristics are the non-heritable changes in the function or structure of a living organism which is caused after birth and was absent before this. Occurrence of acquired traits could be due to disease, injury, accident, deliberate modification, variation, repeated use, or other environmental influence.

For example, the giraffe stretched its neck while reaching for the higher leaves but her children does not get a long neck by birth however this character has been fixed with time because of the repeated use of the neck for food.

Therefore, the correct option is A.

Learn more about Traits here:

https://brainly.com/question/24886772

#SPJ6

All of the animal and plant populations living in a particular area make up a ____.
A. population
B. community
C. habitat

Answers

Answer:

A) population

Explanation:

Answer:

A. population

Explanation:

for example, you may see the population of a town, right? different segments of nature make up what i like to call "wild life towns"

for example, on a map, you may see population of a certain species for square mile.

Suggest reasons for the color patterns of the frog and its lack of color on the ventral surface.

Answers

Answer:

To save itself.

Explanation:

The color patterns of the frog and its lack of color on the ventral surface allows the frog to protect itself from their predators because the frog changes its colour and the predators are unable to see them. The color patterns of frogs and their lack of color on the ventral surface allow frogs to escape from their predators. If the frog does not change its colour, the predators will see them and the frog will be catch by its predators and feed on them so this is the reason that frog changes colour or the presence of colour patterns.

In Amish populations, we see a much higher amount of a specific type of dwarfism compared to the rest of the human population. Which term is best applies to this situation?




Both of these

Genetic Drift

Founder Effect

None of these

Answers

Answer: Both of these

Explanation: trust me

List 4 characteristics of Animals.

Answers

Answer:

animals

Explanation:

The Animal Kingdom

Animals are multicellular.

Animals are heterotrophic, obtaining their energy by consuming energy-releasing food substances.

Animals typically reproduce sexually.

Animals are made up of cells that do not have cell walls.

Animals are capable of motion in some stage of their lives.

Will this process below ensure with certainty that the offspring will retain their needles? Explain your answer.

Chastagner emphasizes that homeowners can minimize needle shedding by keeping their displayed trees well-supplied with water. In fact, when he has set up trees for research in early December and kept them watered, some species, like noble and Nordmann fir, have gone even three months with only minimal shedding.

Answers

Answer:

I'm in school I'll help you when get home around 4:30

What organisms are capable of cellular respiration?

A. Heterotrophs only
B. Animals and fungus
C. Animals, fungus, and some bacteria
D. Protists
E. All organisms

Answers

the answer is E. All organisms

PLSSS HELP WITH THIS IMMEDIATELY!!!!! only answer if u know, i’ll be giving brainiest to the right answert

Answers

Answer:

I cant see the question just use the snipping tool to tack a screenshot

Explanation:

In a sample of double stranded dna if 19% of the nitrogenous bases are guanine what percent of the nitrogenous bases are adenine

Answers

Answer:

31%

Explanation:

Chargaff's law says the amount of A (adenine) = T (thymine) and G (guanine) = C (cytosine). If

G = 19% then C= 19%

19% + 19% = 38%

100% - 38% = 62%

62% for A and T

Divide by 2 and you get

31%

c) Explain why wheat is not able to grow well in
nitrate poor soil.

Answers

Answer:

When soil available nitrogen is low, yield and protein content will be low. As nitrogen is applied beyond these levels the wheat plant will no longer use it to

When uncontrolled, the cell cycle becomes cancer. It forms lumps called..?

Answers

Answer:

Tumours are groups of abnormal cells that form lumps or growths. They can start in any one of the trillions of cells in our bodies.

Explanation: (:

Answer:

It forms lumps called tumors.

PLEASE HELP I NEED HELP (Plant related / Project stuff)

Answers

Answer:

B, D, A, E, C

Explanation:

1. environmental factors

2. growth

3. adaptation

4. organism

5. genetic factors

Who ever Answer this right will get brainliest ​

Answers

Answer:

See Explanation

Explanation:

Pathogens are disease causing organisms in the body. They attack diverse cells, organs, tissues and systems in the body thereby causing them to malfunction (to become diseased).

Antibodies are the body's natural protective mechanism against pathogens.  Antibodies engulf these pathogens and digest them. Then they produce certain chemicals called antitoxins which now destroy the toxins produced by these pathogens in the body.

Also they activate the systems involved in fighting pathogens by punching the cell wall of invading pathogens.

Help me please! Do 1,2,3 by filling in the blank!!!!

and no website

Answers

The answer is Glucose

what was explained by darwins theory of biological evolution

Answers

Answer:

When Organism A has a trait that negatively impacts it, or lacks a trait which would positively impact it, then said organism perishes, and its genes are not passed onto the next generation. On the flip side, when Organism B has a trait that positively impacts it, or lacks a trait that would negatively impact it, then the organism thrives, and its genes are passed onto the next generation.

Therefore, the next generation receives genes from Organism B and does not receive genes from Organism A. So, the next generation has traits that positively impact it and lacks traits that would negatively impact it, thus evolving according to Darwin.

Explanation:

What was explained by it? Evolution. But how did it explain evolution? That is in the answer.

Other Questions
Which of these correctly describes the layer of Earth that has the highest temperatures?The crust is the hottest because it is closest to the Sun.The mantle is the hottest because it is the thickest layer.The outer core is the hottest because it is composed of liquid rock.The inner core is the hottest because it is under the most pressure.Please English Thank you:) Empareja el pronombre con el mandato. Pair the correct pronoun with the command.Match Term DefinitionNo vengas tarde A) a tu profesoraNo lleven mucha ropa B) a los pasajeros en un tour contigoNo salgamos solos C) tu compaero de la escuelaNo lleve una cmara grande D) tus mejores amigos How is the bond between carbon and hydrogen in methane DIFFERENT from the bond between potassium and hydrogen in potassium hydride? using kenya as an example,,,,,,,evaluate the role of primate cities in national development If jada can walk 2 miles in 1.5 hours, how long will it take jada to walk 6 miles? Multiply (-5)^3 (raised to the third power) What is an accountantwhat do they do for a living Which factor is an example of a geographical situation that would promote the rise of a city?A) the climate of the city B) the physical attributes of the cityC)a city's access to natural materialsD)The city's access to long-distance commerce. Referring to the figure, find the surface area of the pyramid shown. Round to the nearest whole number. A bird was perched on a tree at a height of 12 feet. The bird then saw food on a branch below anddropped down 4 feet. What is the current height of the bird? 1. Describe your ideal occupation once you have become a full pledge working professional in the future.2. What responsibilities do you think are attached to the ideal occupation you mention above?3. What are the skills you think you should possess to carry out the responsibilities attached to your ideal job?4. What steps do you think are necessary in order for you to acquire those skills?5. How do you think will you be able to know if you were successful in your ideal job? essay po siya need help po plsss I NEED HELP ASAP!!! (NO LINKS)FULL EXPLANATION WILL GET BRAINLIEST!!!#33 During which change is heat energy absorbed?A. FreezingB. MeltingC. Condensation D. Deposition What is the equation in point-slope form of a line that passes through the points (3, 5) and (8, 4) ? hello mga ka branly please help me my question thank you for your answer SHUCRAN please helpppppppppppppppppppppppp list the health experiences you can learn from your family members. what's A B' in its simplest form? Find the value of y' when xO ifxy^8 + e^y/5 == e. how did the us government sell the war to the nation Steam Workshop Downloader