Indicate which one of the two species is larger
A. Mg2+ or Ca2+

Answers

Answer 1

Answer:

Ca2+ is larger than Mg2+

Explanation:

Mg2+ has total 10 electrons and Ca2+ has total 18 electrons. So, Ca2+ will have more no of subshell which means greater particle size.


Related Questions

The reaction AgNO3(aq) + NaCl(aq) → AgCl(s) + NaNO3(aq) is a_________

reaction. please help

Answers

Answer:

it's a precipitation reaction.

Explanation:

the solid produced is insoluble with water–making it a precipitate.

How many molecules are in 13.2 g NO2?

Answers

Answer:

No. of molecules= mass/molar mass ×avogadro no.

                         =  13.2/50×6.02×10°23

  No. of molecules =1.59×10°23

Explanation:

For the reaction C+2H 2 —->CH 4 calculate the percent yield if 98 g of methane is produced when 100. g of carbon reacts with an excess of hydrogen?

Answers

The percent yield : 73.5%

Further explanation

Given

Reaction

C+2H₂⇒CH₄

Required

The percent yield

Solution

mol of Carbon(as a limiting reactant) :

[tex]\tt \dfrac{100}{12}=8.3[/tex]

mol CH₄ based on C, and from equation mol ratio C : CH₄, so mol CH₄ = 8.3

Mass of Methane(theoretical yield) :

[tex]\tt mass=mol\times MW\\\\mass=8.3\times 16=133.3~g[/tex]

[tex]\tt \%~yield=\dfrac{actual}{theoretical}\times 100\%\\\\\%yield=\dfrac{98}{133.3}\times 100\%=73.5\%[/tex]

A physical change is __________ if energy is given off.

Select one:
a. exothermic
b. endothermic
c. a chemical change
d. not possible

Answers

Answer:

A

Explanation:

A group of students were discussing the lonization energies of Selenium and Flourine. Which student is correct for the reason why their element has the highest lonization energy? O A Student C says F because the larger the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction the more energy is needed to remove a valence electron. B. Student B says Se because the smaller the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction, the more energy is needed to remove a valence electron. C. Student D says F because the smaller the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction, the more energy is needed to remove a valence electron. OD. Student A says Se because the larger the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction the more energy is needed to remove a valence electron.​

Answers

I think the Answer is C because Flourine is stronger in electron attraction and is smaller so it has a stronger electronic pull. Hope this helps :)

Many organisms in an ecosystem compete with each other for resources. What might different species of trees in a forest ecosystem compete for?

Answers

Answer:

Water

Explanation:

Answer:

Water

Explanation:

Becasue the forest needs water to survie they may all compete for it.

i need help asap. which are the products?

Answers

Answer:

A

Explanation:

The products of a chemical equation is what is being experimented with. However, the results in which you get are known as your solution.

Atoms of which element below are most likely to gain electrons?
Group of answer choices:

carbon

lithium

zinc

phosphorus

Answers

Answer:

Carbon and phosphorus

Explanation:

The atoms of carbon and phosphorus are most likely to gain electrons from the given choices .

The reason for this is because, both carbon and phosphorus are non-metals. Most non-metals usually accept electrons.

Metals are usually electron donors .

Metals are known for their electropositivity which is their ability to lose electrons. Non-metals are electronegative and will tend to have a strong affinity for electrons.

plzzzzzzzzzzzzz help i will mark you brainlest true orfalse/Air masses are responsible for the weather in a region

Answers

Answer:

True

Explanation:

Answer:

It is true!

I hope this helps. Have an awesome day <3

What is the sequence in the formation of the Earth and the Universe?


The Earth and Universe formed around the same time


The Earth formed billions of years after the Universe formed


The Universe formed millions of years before the Earth formed


The Earth Formed before the Universe formed

Answers

Answer:

The Earth formed billions of years after the Universe formed

Explanation:

The "universe" is said to have been formed billions of year ago through an explosion. This was called the "Big Bang Theory." This lead to the expansion of the universe owing to its high temperature and density. After which, the universe cooled down. Galaxies and stars were then formed. Some of the stars died due to explosion, which then led to the creation of planets. Such formation of the planets happened around 4.5 billion years ago. This is 9.3 billions of years later than the universe was formed (13.8 billions of years ago). So, this explains the answer.

What actions can you take to reduce your impact on society?

Answers

Answer:

Cut Down On Waste. One of the simplest ways you can reduce your impact on the planet is by cutting down on waste. ...

Support Sustainable Companies. ...

Limit Your Meat Intake. ...

Reduce Energy and Water Use. ...

Offset Your Carbon Emissions. ...

Re-purpose, Recycle, and Borrow.

Explanation:

Plz mark brainliest thanks

Which of the following is composed mostly of ice?


Asteroids


Gaseous planets


Comets


Meteorites


Stars

Answers

Answer: The answer is C- comets!                                                                            

Explanation:  Callisto is composed mainly of rock and water ice, although other ices like ammonia ice and carbon dioxide ice may be present. Water ice occurs at the surface of Callisto so it would be comets.

2. What is the smallest unit of an organism that is classified as living? *
10 points
A. an atom
B. a molecule
C. an organ
D. a cell

Answers

Answer:

D

Explanation:

The cell is the basic structural, functional and biological unit of all known living organisms. Cells are the smallest unit of life that is classified as a living thing, and are often called the "building blocks of life.

Answer:

a cell

Explanation:

All living things are made of cells; the cell itself is the smallest fundamental unit of structure and function in living organisms.

Which one is correct? Please hurry, the audio is just reading the question!

Answers

I think it is D! Hope this helps

If the absolute temperature of the gas in a balloon is halved, by how much will its volume change?

Answers

Answer:

Volume also reduced to half

Explanation:

Volume and absolute temperature are directly proportional to each others

How are mass and density different

Answers

Answer:

An object's density is the ratio of mass to volume of an object. The mass is how much it resists acceleration when a force is applied to it and generally means how much of an object or substance there is.

Answer:

brainleist

pls

Explanation:

An object's density is the ratio of mass to volume of an object. The mass is how much it resists acceleration when a force is applied to it and generally means how much of an object or substance there is.

For the chemical reaction of ammonia combustion, write the expressions for velocity chemical reactions as a change in the concentration of all participants: 4 NH 3 (S ) + 5O 2 ( g )  4 NO ( g ) + 6 H 2 O ( g )

Answers

Answer:

See explanation

Explanation:

We define the rate of reaction as the rate of disappearance of reactants or the rate of appearance of products. The negative sign written before the rate of change of concentration of reactants shows that their concentration decreases with time.

The rate of reaction in terms of the concentration of each reactant or product is shown below;

Rate = -1/4d[NH3]/dt

Rate = -1/5d[O2]/dt

Rate = 1/4d[NO]/dt

Rate = 1/6[H2O]/dt

Convert the following word equation into a formula equation
fluorine + aluminum bromide → bromine + aluminum fluoride

Answers

Explanation:

Fluorine: F-

Aluminium: Al3+

Bromine: Br-

3F2 + 2AlBr3 => 3Br2 + 2AlF3

The balanced equation for the given chemical reaction can be given as

3F[tex]_2[/tex] + 2AlBr[tex]_3[/tex] [tex]\rightarrow[/tex] 3Br[tex]_2[/tex] + 2AlF[tex]_3[/tex]

What is balanced equation?

An equation for just a chemical reaction is said to be balanced if both the reactants as well as the products have the same number of atoms and total charge for each component of the reaction. In other words, both sides of both the reaction have an equal balance of mass and charge.

The products and reactants of a chemical reaction are listed in an imbalanced chemical equation, but the amounts necessary to meet the conservation of mass are not specified.

The balanced equation for the given chemical reaction can be given as

3F[tex]_2[/tex] + 2AlBr[tex]_3[/tex] [tex]\rightarrow[/tex] 3Br[tex]_2[/tex] + 2AlF[tex]_3[/tex]

Therefore, the balanced equation for the given chemical reaction can be given as

3F[tex]_2[/tex] + 2AlBr[tex]_3[/tex] [tex]\rightarrow[/tex] 3Br[tex]_2[/tex] + 2AlF[tex]_3[/tex]

To know more about balanced equation, here:

https://brainly.com/question/29769009

#SPJ2

A sample of Nitrogen gas has a volume of 80.0 L at STP . If the temperature is held Constant what will the volume be at a pressure of 150 kPa?

Answers

Answer:

The final volume of the Nitrogen gas is 54.03 L.

Explanation:

Given;

initial volume of the Nitrogen gas, V₁ = 80 L

initial pressure of the Nitrogen gas, (at STP), P₁ = 101.3 kPa

final pressure of the Nitrogen gas, P₂ = 150 kPa

If the temperature is held constant, apply Boyle's law to determine the final volume of the Nitrogen gas.

V₁P₁ = V₂P₂

[tex]V_2 = \frac{V_1P_1}{P_2} \\\\V_2 = \frac{(80 \ L)(101.3 \ kPa)}{150 \ kPa} \\\\V_2 = 54.03 \ L[/tex]

Therefore, the final volume of the Nitrogen gas is 54.03 L.


N204(0) + 2NO2(g)
Colorless Brown
Keq = 6.16 x 103
What is the predicted direction of change?

Answers

setup 1 : to the right

setup 2 : equilibrium

setup 3 : to the left

Further explanation

The reaction quotient (Q) : determine a reaction has reached equilibrium

For reaction :

aA+bB⇔cC+dD

[tex]\tt Q=\dfrac{C]^c[D]^d}{[A]^a[B]^b}[/tex]

Comparing Q with K( the equilibrium constant) :

K is the product of ions in an equilibrium saturated state  

Q is the product of the ion ions from the reacting substance  

Q <K = solution has not occurred precipitation, the ratio of the products to reactants is less than the ratio at equilibrium. The reaction moved to the right (products)

Q = Ksp = saturated solution, exactly the precipitate will occur, the system at equilibrium

Q> K = sediment solution, the ratio of the products to reactants is greater than the ratio at equilibrium. The reaction moved to the left (reactants)

Keq = 6.16 x 10⁻³

Q for reaction N₂O₄(0) ⇒ 2NO₂(g)

[tex]\tt Q=\dfrac{[NO_2]^2}{[N_2O_4]}[/tex]

Setup 1 :

[tex]\tt Q=\dfrac{0.0064^2}{0.098}=0.000418=4.18\times 10^{-4}[/tex]

Q<K⇒The reaction moved to the right (products)

Setup 2 :

[tex]\tt Q=\dfrac{0.0304^2}{0.15}=0.00616=6.16\times 10^{-3}[/tex]

Q=K⇒the system at equilibrium

Setup 3 :

[tex]\tt Q=\dfrac{0.230^2}{0.420}=0.126[/tex]

Q>K⇒The reaction moved to the left (reactants)

Answer:

The system will shift toward the products

The system is at equilibrium

The system will shift toward the reactants

Explanation:

This is correct on edg... Good Luck!!!!

When the equations Na + O2 → Na2O is balanced the coefficient for O2 is
a) 1
b) 2
c) 3
d) 4

Answers

A) 1

4Na +O2 products to 2Na2O

The coefficient of oxygen gas (O2) in the following balanced equation is: 4Na + O2 → 2Na2O, is 1.

BALANCING EQUATION:

A balanced equation is an equation that contains the same number of atoms of each element on both sides of the equation.

Balancing a chemical reaction requires the use of coefficients, which are numbers placed in front of the elements/compounds involved.

According to this question, the following reaction is given:

Na + O2 → Na2O

The balanced chemical equation using coefficients is as follows:

4Na + O2 → 2Na2O

This balanced equation shows that 1 mole of oxygen is involved, hence, the coefficient is 1.

Learn more about coefficient of balanced equation at: https://brainly.com/question/21049751?referrer=searchResults

Helpz me pleaz! I don't quite get it

Answers

Answer:

Al2O3

Explanation:

Al2O3 has an ionic bond because the bonds between them are very strong

KBr and Al2O3 it’s due to relative size of oxygen and aluminum and polarizing power of Al

HELPPPPPPPPPPPPPPPPPP!!!!!!!!!!!!!!!!

Answers

Answer:

dalton

Explanation:

believe his first name is james, if your not to sure search it

I think the only answer it Rurherford

In trying to control fall armyworms in crops, an Agriculture extension officer applied cypermethrin which was prepared by dissolving 200g of the cypermethrin , C22H19Cl2NO3 in 1000g of water H2O . Calculate the mole fraction of cypermethrin in the solution.

Answers

Answer:

Mole fraction for C₂₂H₁₉Cl₂NO₃ = 0.0086

Explanation:

Mole fraction remains a sort of concentration. It indicates:

moles of solute / (moles of solute + moles of solvent)

Moles of solute / Total moles.

Solute: Cypermethrin → C₂₂H₁₉Cl₂NO₃

Solvent: Water (PM = 18g/mol)

We calculate moles from solvent: 1000g /18 g/mol = 55.5 moles

We calculate PM for C₂₂H₁₉Cl₂NO₃

12g/mol . 22 + 1g/mol . 19 + 35.45 g/mol . 2+ 14g/mol + 16g/mol . 3 = 416 g/m

Moles of solute: 200 g / 416g/mol = 0.481 moles

Total moles: 0.481 + 55.5 = 55.98 moles

Mole fraction for C₂₂H₁₉Cl₂NO₃ = 0.481 moles / 55.98 moles = 0.0086

Replication, Transcription, and Translation Chart
Please answer


DNA Replication:

1。Template Strand: Start with this nucleotide chain.

TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC



2。Complementary DNA Strand: Write directly below template strand.


Transcription:

3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).



Translation:

4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).



5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).



6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).

Answers

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop

Conduction, convection and radiation can occur in variety of ways. Give another example, like the campfire picture above, where you have seen all three methods occur.

Answers

Answer: Boiling water

Explanation:

What is the mass of 5 moles of Fe2(CO3)3 ?

Answers

Answer:

1218.585

Explanation:

Looking at the subscripts we know there are 2 atoms of Fe, 3 atoms of C, and 6 of O.

Take the molar mass of each atom (from the periodic table) and multiply by the # of atoms

Fe: 55.845×2= 111.69

C: 12.011×3= 36.033

O:15.999×6=95.994

Add the values together: 243.717 g/mol

That is 1 mole of the molecule. Multiply by 5 for the final answer.

243.717×5=1218.585

What is independent variable

Answers

An independent variable is a variable that stands alone and isn’t changed by the other variables you are trying to measure.

Answer:

An independent variable is exactly what it sounds like. It is a variable that stands alone and isn't changed by the other variables you are trying to measure.

what is the purpose of chemistry?

Answers

Answer:

To know more about chemicals and how to utilise them to solve man's probl

2. Explain how to determine the wavelength of a wave.
Type your answer here.
I

Answers

Answer:

Hope it helps:)

Explanation:

Wavelength can be defined as the distance between two successive crests or troughs of a wave. It is measured in the direction of the wave. This means the longer the wavelength, lower the frequency. ...

To find the wavelength of a wave;

The wavelength is calculated from the wave speed and frequency by λ = wave speed/frequency, or λ = v / f.

Other Questions
Because he was so embarrassed by losing the war to the colonists, King George almost gave up his... * Once you start designing the processing logic for each function of your software, you might end up throwing out your logical data model design and completely redesigning it. aFalse bTrue The perimeter of the rectangle is 28 units. What is the value of w? What is the difference between Russian food and American food? HELP QUICK PLZ!!!!!!!Question 1(Multiple Choice Worth 1 points)(04.01 LC) What is a molecule called when it has more than one element? Atom Cell Compound OrganQuestion 2(Multiple Choice Worth 1 points)(04.01 LC) The way living things are organized can be represented on a chart. A portion of the organization chart is shown below:A box labeled Cells has an arrow pointing right towards another box labeled X. The box labeled X has an arrow pointing right towards another box labeled Organs.What best represents X? Atoms Molecules Organisms TissuesQuestion 3(Multiple Choice Worth 1 points)(04.01 LC) Which of the following is the highest level in the organization of living things? Organ system Organism Tissue CompoundQuestion 4(Multiple Choice Worth 1 points)(04.01 LC) What is a group of specialized cells called when they work together to perform a specific function? Atom Organ Organ system TissueQuestion 5(Multiple Choice Worth 1 points)(04.03 LC) Which part of a living cell is called the powerhouse because it carries out cellular respiration to make energy? Mitochondria Nucleus Ribosome VacuoleQuestion 6(Multiple Choice Worth 1 points)(04.03 LC) Which of the following best matches a part of a living cell with the function it performs? Cytoplasm: green structure inside plant cells Nucleus: green structure inside plant cells Cytoplasm: directs all of the cell's activities Nucleus: directs all of the cell's activitiesQuestion 7(Multiple Choice Worth 1 points)(04.03 MC) Two cell organelles are described below.Organelle A: Present in plant cells but not present in animal cellsOrganelle B: Much larger in size in plant cells than in animal cellsWhich of the following is most likely correct? Organelle A is vacuole, Organelle B is chloroplast Organelle A is chloroplast, Organelle B is vacuole Organelle A is nucleus, Organelle B is mitochondria Organelle A is mitochondria, Organelle B is nucleusQuestion 8(Multiple Choice Worth 1 points)(04.03 MC) What will most likely happen in the absence of a vacuole? Photosynthesis will not take place. Genetic information will not be transmitted by the cell. Energy will not be released during cellular respiration. The cell will not store food, water, nutrients, and waste.I will give brainliest for first one to get all right!!! p l e a s e h e l p m e e e e Write down the steps to take if you have been a victim of SA or SH Open this article again here. Look at the blunderbuss. Read the text that accompanies the picture, and then answer the question. Lewis and Clark used this weapon mainly to hunt for food. battle with enemies. impress American Indians with their power. Why was the development of standard weight measurement important in ancient India?It made taking measurements easier and improved trade.Measurements became easier to estimate in ancient India.A precise ruler was used to measure the weight of objects.Standard weights could be made from available wood. Fill in the blank with the correct compound.______ glaubst du?WorausWoranWomitWorauf A park has a 3m tall tetherball pole, and a 6.8m tall flagpole. The lengths of their shadows are proportional to their heights. 1. What schools rules would you be willing to break to maintain the respect of your peers as well as your own self-respect?2. What unspoken or unofficial rules do you follow in order to maintain the respect of your peers as well as your own self-respect?3. What hardships have you overcome that threatened to rob you of your pride and self-confidence? (please just give me an example because i don't know how to answer this)4. Describe the people from your own life who display personal pride and dignity. (also just give me an example so i can think of something) SPANISH 1 can you explain why your answer is that as well Id be grateful for it thank you Which party split over the Payne -Aldrich Tariff ( & other issues )? Calculate the marked price of a sweater purchased at Rs. 1075 allowing 14% discount. ( please do proper answer ) According to the excerpt above, are these sentences T or F 1) one possible consequences of overpopulattion is conflict between people. 2) Paul Enhrlic had an optimistic view of the future. 3) The global population will rise to nine billion by 2050. 4) Thomas Malthus believed tha human society coul never be perfected becuase human are ,by nature, lazy Attendance at baseball games Describe in detail the 6 points of Union warfare using specific examples of battles and officers that helped fulfill them.\ solve the system of linear equations using subsitution. {y=2x-1. {y=x-8 Explain how the aperture geometry relates to thediffraction pattern. Steam Workshop Downloader