------ is the study of people and how they develop.

A. anthropology
B. historian
C. archaeologist
D. zoologist


SOMEE ONEE HELPP MEE

Answers

Answer 1
C.) Archeologist! Hope this helps :)

Related Questions

japan firmly established its culture in the country of

Answers

Answer:

Japan firmly established its culture in the country of Korea.

Japan firmly established its culture in the country of Korea.

What impact did Japan culture had on Korea?

Between 1910 and 1945, Japan worked to wipe out the Korean culture, language and history to the extent.

The Japanese tried to merge Koreans into the Japanese empire by changing their laws, policies, religious teachings and education to influence the Korean population.

In order to, establish control over the Korea, the Empire of Japan also started an all-out war on Korean culture as well.

Learn more about the Japan culture here:-

https://brainly.com/question/13591334

#SPJ2

u.s. and foreigen companies have built factories in Mexico because they

Answers

Answer:

IMMEX drives down the cost business – The ability to temporarily import raw materials and manufacturing costs duty free has made manufacturing in Mexico an enticing option. The cost savings on duty alone have been enough to encourage many American companies to make the switch.

Explanation:

none.

Because they wanted to

Who is Abigence Waldo?

Answers

From the diary of a Surgeon at Valley Forge

Answer:

Albigence Waldo Dr. Waldo was the brother of Abigail Waldo, the wife of David Bucklin. David was an uncle of Joseph Bucklin 5th, who fired the first shot of the Revolution and for whom this Joseph Bucklin Society is named. David Bucklin served in the Revolutionary Army, as did many of the Bucklins who were close relatives of Joseph Bucklin 5th.

04.PMA
Which was an impact of the Magna Carta on the government of the United States?
natural rights
social contract
limited government
separation of powers

Answers

Answer:

natural rights

Explanation:

Magna Carta was widely held to be the people's reassertion of rights against an oppressive ruler, a legacy that captured American distrust of concentrated political power.

What was the result of the French and Indian War?

The Indians lost all of their territory and were pushed west of the Mississippi.

The French won and expanded their territory northward all the way into Canada.

The French lost the war and had to give up their territory west of the Mississippi.

The British won and acquired Canada and all the land as far west as the Mississippi.

Answers

Answer:

As a result of the French and Indian War, the British defeated the French but the amount of land they claimed didn't grow, The British won and acquired Canada and all the land as far west as the Mississippi.

Explanation:

As a result of the French and Indian War, The British won and acquired Canada and all the land as far west as the Mississippi. Thus, option D is correct.

What is War?

A military action involving two or even more sides is referred to as a war.   a few have contended that politics, religion, and the economy are the main causes of war. A conflict that lasts for a long time and is only resolved when one side no longer has the resources like soldiers, and weapons, to carry out further operations.

The desire for supremacy in North America by Britain and France was indeed the catalyst for the French as well as Indian War.

Great Britain gained enormous land in North America as a consequence of the Agreement of Paris, along with all French territory east of both the Mississippi River and Spanish Florida. Therefore, option D is the correct option.

Learn more about the French and Indian War, here:

https://brainly.com/question/5215464

#SPJ2

Cause
Effect
A plantation system
develops in the Southern
colonies.
?
A. Southern colonies ban debtors from their territory.
B. Southern colonies pass laws protecting slavery.
C. Southern colonies grow fewer cash crops.
D. Southern colonies are drawn into conflict with Puritans.
I

Answers

Answer:

southern colonies ban debtors from their territory

Select all that apply.

_____ is an example of a postsecondary degree.

Specialist's
Master's
Bachelor's
Associate's

Answers

Answer: I think its Bachelor's and Associate's but i'm not sure

Accosiate bachelors and masters are all post secondary

Compare and contrast the arguments for and against capital punishment.

Answers

Answer:

If capital punishment should be used i mean if the punishment is that bad and that person did something that bad they i support it, but it shouldn't be your first choice.

Explanation:

i got it right

Answer:

Responses will vary. A sample response follows:

Explanation:

Some people believe capital punishment, also known as the “death penalty,” is wrong. Others believe it is appropriate for some situations. It is important to note that even proponents believe that the death penalty is only appropriate for treason, terrorism, murder, and a few other offenses. Capital punishment is legal in 35 states. Detractors believe capital punishment is not consistent with a modern and moral society. Over one-hundred thirty nations around the world have banned it, and the United States is the only Western nation to still allow the death penalty.

hope this helps :]

ITS TIMED






Why do Christians call Jesus "the Christ"?
Christ comes from the Greek word for Messiah.
Christ comes from the Greek word for salvation
O Christ comes from the Latin word for Nazareth.
Christ comes from the Latin word for Resurrection

Answers

Answer:

Christ was not originally a name but a title derived from the Greek word chrīstós. Yes No No No

Answer:

The answer is A.

Explanation:

In the Greek Septuagint, christos was used to translate the Hebrew מָשִׁיחַ (Mašíaḥ, messiah), meaning "[one who is] anointed".

Read this excerpt from the Declaration of Independence.

Answers

i think ur suppose to read it

Answer:

yes

Explanation:

because I read this now

What war did France lose in 1761? What effect did this have on France?​

Answers

Answer:

The Seven Years' War ended with the signing of the treaties of Hubertusburg and Paris in February 1763. In the Treaty of Paris, France lost all claims to Canada and gave Louisiana to Spain, while Britain received Spanish Florida, Upper Canada, and various French holdings overseas.

Explanation:

Why did Johnson feel that Congress had to support the Voting Rights Act?​

Answers

Answer:

He thought that African Americans should have the right to vote that way everyone had a say because it wasn't fair.

Enter the word you received when you completed the review questions on the Gold Rush .

Answers

Answer:

Transcendental

Explanation:

Answer:

Transcendental

Explanation:

Which of the following is an example of the idea of "separation of powers" in the American constitutional system?

Each state elects representatives and senators to Congress.
The process for creating laws involves Congress and the president.
The military is allowed to make decisions without the president's approval.
Congress is allowed to pass laws without approval of the president.

Answers

B. The process for creating laws involves Congress and the president.

Explanation:

The idea of "separation of powers" is very important and creates balance within the American constitutional system. Since all of the branches are equal in power, this means they check each other and prevent one another from abusing their power.

There are three branches in the United States government, legislative, executive, and judicial.

~The legislative branch is responsible for making the laws.

~The executive branch carries out these laws.

~The judicial branch will then interpret these laws.

Along with this, the legislative branch consists of the Senate and the House of Representatives, which together form Congress. The President resides within the executive branch, along with the Vice President and the Cabinet. The judicial branch holds the Supreme Court and other federal courts.

Answer:

The process from creating laws involves the Congress and president.

Explanation:

Seperation of powers is the way the government uses to make sure one branch doesn't over power the other. That's why making a law is a long process because you need lots of approval.

Are monopolies good for consumers (people who buy things)?
a
Yes
No

Answers

Answer:

Yes

Explanation:

I had this question before and it was yes.

Answer:

No

Explanation:

Because buying can become an habit, then to an addiction. And eventually as the consumer buying all the goods from monopolies you won't focus on your priorities in your household that eventually you end up in debt. And then you won't be able to afford your needs then you get evicted and lose your home. Then you are faced with poverty, and life goes downhill

35° 02’ North is an example of ____________ a. absolute location. c. a mile marker. b. relative location. d. directions to Santa Fe.
Pleaseeee helppp meee

Answers

Answer:

A. Absolute Location

Explanation:

Absolute location is the exact coordinates of a location, which is shown here. Relative location is where something is in relation to something else. This is not a mile marker or directions to Santa Fe either.

Have a wonderful day! :D

Answer:

A

Explanation:

Give the social dimension of the Paschal Mystery?

Answers

Explanation:

in my opinion the social dimension of the Pascal mystery is by Respecting life of every individual,having respect for the dignity of everyone,sharing materials and food and protecting essential rights just as Christ did for everyone

(Thanks and sorry)

True faith always has a social dimension.

How might Stephens's position have influenced his
point of view?
He was hired by the trustees and could see
firsthand that their laws were not working.
He was the father of a malcontent leader and could
understand their frustrations.
He was a farmer and disagreed with the trustees'
plan to grow silk in the colony.
He worked for the trustees, and only wrote
positively about their economic policies.

Answers

Answer: (D) He worked for the trustees, and only wrote positively about their economic policies.

Explanation: right on edge 2020

Answer:

He worked for the trustees, and only wrote positively about their economics policies.

Explanation:

I need help !!! What was a major reason why France wanted to control Louisiana ?

Answers

They wanted to have more land, so they could have more power and more armies to fight with so they can rule.

ANSWER FAST.
what were the economy of:

new england colonies.
middle colonies.
southern colonies.​

Answers

Answer:

new england had fishing and fur trade middle colonies had wheat and tobacco and southern had cotton and other cash crops

Explanation:

The transcontinental railroad changed America in fundamental ways. In a short paragraph, explain at least three motivations Americans had for building a railroad that stretched from coast to coast.

Answers

Answer:

Responses may vary but should include some or all of the following information: Americans believed that a transcontinental railroad could fundamentally change transportation. Before the railroad, sending goods from coast to coast was a long, expensive process. The new rail line allowed Americans to travel and ship goods quickly and cheaply, which encouraged the growth of commerce. The railroad also helped American industries grow, as new transportation allowed Western resources to travel to Eastern cities. Mining, lumber, and cattle industries all benefited from these changes. You could also say: It's going to encourage interstate commerce. Commerce between states because it's going to be much easier to ship goods and services across state lines because of this railroad. It's going to provide for a faster and cheaper way of transportation than overland travel. And it's going to help economically by developing mining, farming, lumber, and cattle industries throughout the United States.

How do constituents, interest groups, and political parties influence how members of Congress vote on legislation?

Answers

Answer:

Constituents, interest groups, and political parties use different kinds of leverage to influence the votes of congressional representatives. Constituents are powerful because they can vote out members who do not represent their interests. Sometimes, however, interest groups and political parties hold more sway over members because they provide money and logistical support for campaigns.

Explanation:

I hope this helps!! ;)

In congress political parties serve to coordinate, assistant and provide ... party leaders on individual members including higher rates of party voting. ... set legislative priorities, and determine who will receive important committee appointments. ... Interest groups attempt to influence Members of Congress in a variety of ways

What is the legacy of Spanish influence on Texas today? Explain three examples to support your argument.

Answers

Answer:

Ranching, farming, language, food and religion.

Explanation:

Ranching was practiced by the Spanish that were settle in Texas is responsible for the cattle industry present today that contributed in the economy of the Texas. The Spanish also introduced a unique type of farming in the valley of San Antonio that were not present before in Texas. They also introduces their language, food and religion that is also practiced in Texas today.

True or false: the book of job was written during the same time period as the book of genesis

Answers

Answer:

In my opinion I think that's False

what arguments do jefferson and dickson repeat in the olive branch petition and declaration of the causes and necessity of taking up arms

Answers

Answer: Olive branch petition was the first action of the Congress to show the conflicted mind of the delegates of the American people.

Explanation:

Thomas Jefferson and John Dickinson were the two leaders who tried to overcome the polarities of the congress. They wrote about it in their documents, collectively called as Olive Branch Petition. It was the declaration about the necessity of taking arms.  It was to warn the kill against the his violence and terror in the colonies of Britain.

Help please!! I’ll give brainliest

Answers

Answer:

Robert Hooke and Antoni van Leeuwenhoek

Explanation:

Robert Hooke who described the fruiting structures of molds in 1665 and Antoni van Leeuwenhoek who is credited with the discovery of bacteria in 1676.

HELPPPP ANYONE ? PLSSSSS

Answers

Answer:

true

Explanation:

Which industry did not exist in the United States until the Second Industrial Revolution?

a. steel

b. railroad

c. shipping

d. mining

Answers

Answer: Steel

Explanation:

Answer:

A STEEEL

Explanation:

brainliest as mark!

Leanne Keene, French ambassador, arrives from Paris to tell you that France needs the money it lent the colonies during the Revolution immediately. Can the Articles of Confederation solves this Problem? Why or why not?

Answers

Answer:

Yes.

Explanation:

Why this is the case is because the Articles of Confederation when addressing issues of finances make provision for the central government to print and borrow money as well as asking individual states for money.

Based on these premises we can expect the colonies to comply as directed by the French ambassador immediately.

I am a word to describe a weak or loose organization of states. The smaller states make their own laws and decisions and the central government is only concerned about a common defense and trade.

Answers

Answer:

Articles of confederation

Explanation:

Other Questions
What does Beowulf foresee concerning Freawarus marriage Carbon decays every 5700 years. If you found a rock containing Carbon that has gone through 2.5 half lives, how old is that rock? Love after Love By Derek Walcott What are machines fueled by?1. Energy 2. Electricity only3. gasoline only4. Sun You measure containers for international shipments. The height of the standard container is 6 feet and 7 inches. What is the height in meters? TIME REMAINING52:45The robotic rover Curiosity has instruments that detect radiation both inside the spacecraft and in the Mars environment. What is most likely the purpose of this radiation detection?to determine whether human exploration of Mars is possibleto develop better X-ray technologyto find evidence of once-living Martian microorganismsto investigate evidence of hydrogen and water (1/3)^2=? I need help with math I'm failing, because of my teacher By finding out who Figaro's parents are how does this inconvenience the Count? Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have Steam Workshop Downloader