Peptide bonds in proteins can be broken down by the enzyme peptidase. Adrianordes a hamburger abd French fries for.lunch. He adds cheese and mayonaise to his hamburger abd then sits down to eat lunch with his friends. Which statement would most likely result from the action of peptidase in Adrians small intestine?
A. Lipid
B. Amino acid
C. Hydrocarbon
D. Glucose

Answers

Answer 1

Answer: Amino Acid

Explanation:


Related Questions

Which factor is different between the tundra biome and a tundra ecosystem?
A. Soil moisture
B. Climate
C. Size
D. Type of plants

Answers

Answer:

b it is the climate

Explanation:

B the climate

Answer  C.Size

Explanation:

the reason why it is not climate is because the climate is the same. So as the soil moisture. The tundra biome is a bigger size than the ecosystem. The order from largest to smallest level of organism: biosphere,biome,ecosystem,community, population, and last organism.

if a person has a dominant gene and a recessive gene for a certain trait which will be expressed

Answers

Answer:

The dominant gene will be expressed

Explanation:

Recessive genes are only expressed when you have two recessive genes and no dominant.

What are the differences between the Big Bang Theory and the Steady State Theory?

Answers

Answer

One is a move and the other is a part of a state.

Explanation:

Answer:

The only difference, he explained, was that in the big bang scenario all the matter was created in one explosive beginning.

Help please!! (3 points)

Answers

Answer:

Its C

165.25cm

Explanation:

What does “denature” mean in terms of protein structure?

Answers

Explanation:

Denaturation, in biology, process modifying the molecular structure of a protein. Denaturation involves the breaking of many of the weak linkages, or bonds (e.g., hydrogen bonds), within a protein molecule that are responsible for the highly ordered structure of the protein in its natural (native) state.

Which accurately labels the cytoplasm?
w
Х
Y
Z

Answers

Answer:

Y is the answer

Explanation:

I am 100%sure that the answer is Y

This is the science of correct reasoning. The basic components are statements that can be true or false, but never both.​

Answers

Answer:

The basic components are statements that can be true or false, but never both. Magnetic Resonance Imaging This is a non-invasive body imaging procedure that uses powerful magnets and radio waves to construct pictures of the internal structures of the body.

Explanation:

Which of the following is a term use to describe a mound, hill of ridge of wind-blown sand?
A.peak
B.hill
C.contour
D.dune​

Answers

The answer is D.dune

Which of the following correctly identifies the function of the cell membrane?
A
controls what enters and leaves the cell
B
produces protein and enzymes
C С
controls the cell function
D
stores genetic infromation for the cell

Answers

Answer:

a controls what enters and leaves the cell

Explanation:

what is carrying capacity? what type of population growth does it affect?

Answers

Carrying capacity is referred to a population size of species in a particular habitat. In an ecosystem, the population of a species will increase till it reaches its carrying capacity. Then the population size remains relatively equal.

What are the types of carrying capacity?

Carrying capacity is the maximum limit till that the ecosystem can support the existence of the population.

There are four categories of carrying capacity, namely:

Physical.Ecological.Economic.Social.

A specific environment's carrying capacity is the maximum population size that it can support.

The carrying capacity modifies the growth rate by slowing it when resources become scarce and stopping growth once it is reached.

Thus, it can be concluded that the carrying capacity is the average population size of species in a particular habitat which slows and stops the growth rate on reaching it.

For more details regarding carrying capacity, visit:

https://brainly.com/question/2375972

#SPJ1

EASY HELP ME Which of the following would be true of a Charophycean type plan
a. They had seeds.
b. They lived in water.
c. They were mosses
d. They were vascular

Answers

Answer:

C

Explanation:

They in fact were mosses and mosses by definition dont have seeds or vascular and Charophycean type plants dont live in water

the answer to this question is C

Select the factors described in the video that the body works to maintain homeostasis.

Group of answer choices

water concentration

temperature

pH level

skin color

eyesight

Answers

Answer:

water concentration, temperature and pH level.

Which of the following is an example of a complex machine?
1. Pulley
2. Wedge
3. Scissors
4. Incline

Answers

3- Scissors are an example of a complex machine.

Answer:

A :3

Explanation:

Just did acceleratted ed. Hope this helps!

What is a carbon producer

Answers

Answer:

There are many many things in the world that produces Carbon. The largest source of greenhouse gas emissions from human activities in the United States is from burning fossil fuels for electricity, heat, and transportation. All of these produce Carbon into the atmosphere and warm the planet

help please n thx <3

Answers

Answer:

The answer is The cell that contains the nucleus.

how might toxicology be important to other biomedical professions outside of forensics?

Answers

Answer: See explanation

Explanation:

Toxicology is a field in science that has to do with the effects of poisons, toxics and how they can be treated. Through toxicology, one can understand how harms are caused by chemicals and the health of the public can be protected.

Toxicologists study chemicals, drugs and other substances, and looks at how safe they're and their impact on living organisms. Toxicologists help in the development of methods that'll be used to know the harmful effects and the the dosages which causes it.

Furthermore, toxicology gives vital information and knowledge which the decision makers or regulatory agencies

in other biomedical fields can use in order to put programs in place that can be used to limit the exposures of humans to the substances.

In conclusion, less exposure to these substances is vital so that diseases can be prevented.

Toxicology is also used in the field of environmental health.

Toxicology will be important to other biomedical professions outside of forensics. Toxicology can be used in environmental health field which provides critical information and knowledge about the toxic substances that can be used by regulatory agencies to limit our exposures to toxic substances so we can say that toxicology plays an important role for other biomedical professions.

Learn more: https://brainly.com/question/18122705

Which element is able to combine in many ways with different elements and is therefore considered the basis of life?

Answers

Answer:

Carbon

Explanation:

Carbon is the answer

What is the use of tail in human sperm?​

Answers

It’s an adaptation that allows the sperm to travel to the egg more efficiently as the distance is long and most sperm do not make it to the egg so this increases the chance of fertilisation.

Explanation:

PLEASE HELP ME I DONT KNOW THE ANSWER!!!!!

Answers

Answer: I think the answer is ( d) because the two tails are together to get stuck in the membrane as the picture shows

Explanation:

HELP!!
What is the correct answer?

Answers

Answer:

the pink one

Explanation:

just had this question

which of the following statements are true?
A. Flavr Savr tomatoes are still commercially successful.
B. A large percentage of US crops are currently genetically engineered.
C. Glyphosate kills all plant life, even genetically altered plants.
D. None of these are true

Answers

B! we had to alter them to our preferred taste and nutrients

The process during which a preexisting cell splits to form two cells is called

Answers

Mitosis is the process of a pre existing cells dividing into two cells.

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC


Highlighted letters are: ATACTACC

Answers

Answer:

1 and 5

Explanation:

https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question

Answer:

1.ATTAGC(ATACTAC)GGGC

5. ATGAATGC(ATACTACC)GGGC

How does agriculture contribute to species loss?

Answers

Answer:

The animal agriculture industry is killing our environment and putting every species on this planet at risk of extinction. The animal agriculture industry's pollution of our air, water and land, along with deforestation and soil degradation, all contribute to habitat loss and species extinction.

Explanation:

what is human intercose

practical of human intercose​

Answers

Answer:

Sexual intercourse, also called coitus or copulation, reproductive act in which the male reproductive organ (in humans and other higher animals)

2. Describe a situation in which unbalanced forces are acting on an object. What is the net force
on the object, and how does the net force change the motion of the object?

Answers

Answer:

The force is by putting the two same objects on both sides and the motion is the scale

The force is by putting the two same objects on both sides and the motion is the scale.

What do you mean by force?

In physics, a force is an influence that can change the motion of an object. A force can cause an object with mass to change its velocity, i.e., to accelerate. Force can also be described intuitively as a push or a pull.

The normal force acts in a direction normal to the surface interaction between objects. Friction is a force that opposes motion on surfaces. Other examples of non-fundamental forces include the elastic force, tension.

Force is the fundamental result of an interaction between two objects, while power is an expression of energy consumed over time (work), of which force is an element.

Learn more about force:

https://brainly.com/question/13191643

#SPJ2

Which of the following events occurs the earliest during the process of photosynthesis?

Answers

Answer:

If you give me the choices to choose from I cna answer.

Explanation:

2. What is the name of the process of gathering evidence called? *
1 point
the Experimental Process
the Scientific Proof
the Scientific Experiment
the Scientific Method

Answers

Answer:

the answer is d scientific method

Answer:d the scientific method

Explanation:

What’s the answer ????????

Answers

it’s d
i looked it up and it’s the exact same:)

Answer:

D: Electrons are transferred from one atom to another.

Explanation:

Protons are not involved in the covalency, and C, electrons are shared between two atoms, is the definition of a covalent bond, such as water. Ionic bonds form when two atoms, share (transfer) electrons to one another in order to fill the outer electron ring.

Hope this helps!

Where is the error in the diagram?



DNA is copied during the shortest stage.


The cytoplasm divides during the longest stage.

The nucleus divides in the stage before the cytoplasm divides.

Both the nucleus and the cytoplasm divide in the same stage.

Answers

Answer:

But where is your diagram

Answer:

C

Explanation:

Other Questions
72 in the ratio 5:4 Of the following statements, which one or ones describe actions helpful to your credit score?1. Quickly paying off debtsII. Having recent debtsIII. Having long-standing lines of credita. I onlyb. II and IIIc. I and HIId. III only seis causas del calentamiento global Write an email to tourism authority of your province Use your knowledge of verbs to choose the correct word in each sentence.ya little English before I moved to the United States.English now,The boyfor his English exam for months. Which statement best explains why invertebrates often have outer skeletons but vertebrates do not?The outer skeleton provides protection, since invertebrates do not have backbones.The outer skeleton surrounds the spinal cord, since invertebrates do not have backbones.The outer skeleton helps invertebrates maintain homeostasis, since they lack spinal cords. The outer skeleton helps invertebrates maintain homeostasis, since they lack membrane-bound organelles. F(x) = -2x^2 + 6x-3, opens (down or up) and has a (maximum or minimum) value Explain Common sense, its impact, and the name of the author who wrote it. Which of the following adjectives would you use to describe Diego?atrevidoestudiosoatlticoartstico 3 stakeholders for racial justice What evidence exists that king tut died from an illness? Forty one thousand,two hundred eleven Describe how you might figure out if something was made out of cells. I need the answer to this question for my math homework 3 = x 11 For each separate case below, follow the three-step process for adjusting the unearned revenue liability account at December 31 Step 1: Determine what the current account balance equals. Step 2: Determine what the current account balance should equal Step 3: Record the December 31 adjusting entry to get from step 1 to step 2. Assume no other adjusting entries are made during the year a. Tao Co. recelves $10,000 cash in advance for four months of legal services on October 1, 2017, and records it by debiting Cash and crediting Unearned Revenue both for $10,000. It is now December 31, 2017, and Tao has provided legal services as planned. hat adjusting entry should Tao make to account for the work performed from October 1 through December 31, 2017? Unearned revenue Step 1: Determine what the current account balance equals. Step 2: Determine what the current account balance should equal Step 3: Record the December 31 adjusting entry to get from step 1 to step 2 b. A. Caden started a new publication called Contest News. Its sub subscriber, Caden debits Cash and credits Unearned Subscription Revenue for the amounts received. The company has 100 new subscribers as of July 1, 2017. It sends Contest News to each of these subscribers every month from July through December Assume no changes in subscribers, prepare the journal entry that Caden must make as of December 31, 2017, to adjust the Subscription Revenue account and the Unearned Subscription Revenue account pay $24 to receive 12 monthly issues. What do you think a wave interaction is? Allocation is the distribution of a good or service. Which equation shows the point-slope form of the line that passes through (3, 2) and has a slope of y plus StartFraction one-half EndFraction equals 3 left-parenthesis x minus 2 right-parenthesis.?y + 2 =y plus 2 equals StartFraction one-third EndFraction left-parenthesis x plus 3 right-parenthesis.(x + 3)y 2 = y minus 2 equals StartFraction one-third EndFraction left-parenthesis x minus 3 right-parenthesis.(x 3)y + 3 = y plus 3 equals StartFraction one-third EndFraction left-parenthesis x plus 2 right-parenthesis.(x + 2)y 3 = y plus StartFraction one-half EndFraction equals 2 left-parenthesis x minus 3 right-parenthesis.(x 2) Describe at least TWO geographic features that you have experienced in your life. Where did you experience these geographic features? In the Four Corners area of thep southwestern United States, there are large rockyoutcroppings of basalt. These were formed by ancient lava flows. Using this information,what class of rock is this? Steam Workshop Downloader