PLZ HELP ME!!!!
2. What happens to sedimentary rocks on Earth’s surface?

Answers

Answer 1

Answer:

Sedimentary rock can change into metamorphic rock or into igneous rock. ... On Earth's surface, wind and water can break rock into pieces. They can also carry rock pieces to another place. Usually, the rock pieces, called sediments, drop from the wind or water to make a layer

Explanation:

Answer 2

Answer:

Sedimentary rocks are formed on or near the Earth's surface, in contrast to metamorphic and igneous rocks, which are formed deep within the Earth. ... Erosion and weathering transform boulders and even mountains into sediments, such as sand or mud. Dissolution is a form of weathering—chemical weathering.

Explanation:


Related Questions

An organ that makes and secretes hormones is called a
1] lung
2]gland
3]pancreas
4]thyroid

Answers

Answer: 2]gland brainliest?

Explanation:

Which technique will researchers studying the inheritance patterns of various disorders most likely use? A. CLADOGRAM, B. DNA FINGERPRINTING, C. GEL ELECTROPHORESIS, D. CHROMOSOMAL ANALYSIS

Answers

Answer:

Chromosomal Analysis

Explanation:

Most of the options are pretty superficial but chromosomal analysis goes in depth therefore you'll get more results and find what could potentially be wrong.

How about decreasing the amount of water in blood affect blood pressure

Answers

Answer:

When you're very dehydrated, your blood volume can decrease, leading to a drop in blood pressure. When blood pressure drops too low, your organs won't receive the oxygen and nutrients they need. You could potentially go into shock.

Which of the following contain stem cells that produce most types of blood cells?
Bone Marrow
O Muscle cells
O Bile
O Plasma

Answers

Bone marrow produces many types of white blood cells.

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Answers

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

How can the appearance of white baby rabbits be explained when the mother has white fur, and the father has black fur?

Answers

Explanation:

because the baby rabbit took after its mother and the

Enumerate ways on how humans produce sound:Ex:clapping your hands
a.__________________________
b.__________________________
c.__________________________
d.__________________________
e.__________________________

Answers

Answer:

vibrating vocal cords, stomping feet, gargling, whistling, cracking your knuckles

Answer:

•shouting•talking•singing•playing instruments•laughing•yelling•screaming•crying

Explanation:

yAn LNG po Alam ko e:^

If you find a fossil in two different locations and it has featured in common with dinosaurs and modern birds, how does this support the evolutionary theory?

a) the two species must not be related
b) looking at the fossils, they show similarities both physically and in their DNA that don't appear to change much over time
c) dinosaurs must have evolved from mammals because their bones are similar in size rather than birds
d) the land must have been together at one point where these two species interbred to share a common ancestor

Answers

Answer: D

Explanation: the continents wee once connected. It was known as Pangea

what is sodium E621 know as MSG is​

Answers

Answer:

MSG is short for monosodium glutamate. It is common food addictive-with the e-number E621 that is used to enhance flavor.

Explanation:

MSG is derived from the amino acid glutamate or glutamic acid, which is one of the most abundant amino acids in nature.

Someone please help me !

Answers

Answer:

A

Explanation:

A becouse planets do move and the sun move around eachother.

1. Place the letters in the correct order for DNA replication (a, b, c): ___
a. Daughter strands are formed using complementary base pairing.

b. DNA unwinds

c. The DNA of the daughter strands winds together with its parent strand.
2.Why is DNA replication called “semi-conservative”? ___
3.What enzyme unwinds or unzips the parent strand? ___
4.What enzyme connects the new bases to the old bases in the DNA template? ___
5.___DNA replication results in two DNA molecules,

a. each with two new strands

b. one with two new strands and one with 2 original strands

c. each with two original strands
d. each with one new strand and one original strand

6.___DNA replication is said to be semiconservative because:

a. both RNA and DNA synthesis are involved in the process.

b. part of the telomere is lost during each round of replication.

c. a new double helix contains one old and one new strand.

d. each new strand is complementary, not identical, to its template

Answers

Explanation:

1. b-a-c

2. Because in each of the new pair of double stranded DNA formed after replication, a parent strand is present in each.

3. Helicase

4. DNA Polymerase

5. Option D

6. Option C

Tell me if you think caecilians are amphibians, reptiles, or fish.

Answers

Answer:

Amphibians

Explanation:

give an example of something that might stop a cell from checking things during the cell cycle

Answers

Answer:

A checkpoint is one of several points in the eukaryotic cell cycle at which the progression of a cell to the next stage in the cycle can be halted until conditions are favorable. ... The G2 checkpoint ensures all of the chromosomes have been replicated and that the replicated DNA is not damaged before cell enters mitosis.

A mutation in a tumor suppressor gene may stop a cell from checking things during the cell cycle.

Tumor suppressor genes are normally expressed genes that control the progression of a cell through the cell cycle.

These genes (tumor suppressor genes) act to repair mutations that occurred during DNA replication, slow down cell division, activate programmed cell death pathways (i.e., apoptotic pathways, etc).

For example, p53 is a tumor suppressor gene capable of controlling cell division rate by keeping cells from proliferating in an uncontrolled manner.

In consequence, mutations of the p53 gene are often observed in cancer cells that lost their ability to regulate the rate at which they grow.

In conclusion, a mutation in a tumor suppressor gene may stop a cell from checking things during the cell cycle.

Learn more in:

https://brainly.com/question/16188646

Hello! could someone please do a 4 sentence quark poem

Answers

Answer:

Quark is a character in the television series Star Trek: Deep Space Nine.

Quark developed a few strong friendships during his stay on Deep Space Nine.

The Ferengi have business deals throughout the galaxy; Quark is no different.

For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.

Explanation:

Why is it we cannot directly observe a genotype, but can sometimes infer it?

Answers

We cannot directly observe a genotype because there are multiple options for genotypes.

At the core of the differences between gender and sex is the chromosomal information transmitted at the moment a child is conceived. An "XY" chromosome generally means A) a heterosexual embryo B) a male embryo C) a hermaphrodite embryo OD) a female embryo​

Answers

Answer:

B) male embryo

Explanation:

Hat percent of electricity in the UK will come from renewable sources by 2010? a. 1% c. 10% b. 5% d. 40%

Answers

Answer:

C, 10%

Explanation:

For the year of 2010, it's definitely 10%

What are the goals of binomial nomenclature and systematics?

Answers

Answer:

The goal of systematics is to organize living things into groups that have biological meaning. the science of naming and grouping organisms.

Explanation:

Help me with this please

Answers

C can be the possible answer!

what does not pass through the stomata of leaves ​

Answers

Carbon dioxide and oxygen cannot pass through but move in and out

Examine the Punnett square below. A cross between the two parents results in 50 offspring. How many of the offspring are most likely to have the dominant trait?

Answers

From what I know a punnet square like that gives a 75 percent chance of the dominant trait to that offspring. I’m not entirely good at the subject but I hope that helps?
75 % ........................

need help, will mark brainliest! plsss.
Which of the following is *not* a physiological mechanism regulated by timing?

Circadian rhythms in eukaryotes
Hibernation of animals during winter
Photoperiodism to direct the flowering of plants- i think its this one
Viral reproduction in a host cell

Answers

Hello, I Am BrotherEye

Answer: Physiological mechanisms explain any health-related events or outcomes. Physiological mechanisms can be altered voluntarily. For example, exercise causes alteration in the cardiac physiology of resting state. ... Multiple physiological mechanisms are responsible for survival of an individual.

Explanation:

It Is Simple Find The Answer Choice That Is The Opposite Of The One Above

In the 1960s, homeostatic regulatory mechanisms in physiology began to be used to describe what normally happens to the value of the regulated variable over time. The body does not possess a physiological sensor for detecting these

I hope that this helps

The fan illustrated here plugs into the wall and blows air to make a room cool.




Which of the following best explains how it works?
A: It reduces heat by producing sound energy.

B: It gets chemical energy from gases in the air.

C: It transform electrical energy into the energy of motion.

D: It spins, sending heat and light energy through its wires.

Answers

Answer:

The only logical answer is C, the other ones don't make sense

Explanation:

I hope this helps! :)

meaning of cell or cytology​

Answers

Answer:

the smallest structural and functional unit of an organism, typically microscopic and consisting of cytoplasm and a nucleus enclosed in a membrane.

Explanation:

Cell is the building blocks of life.

What would happen if there is an obstruction in the vas deferens?​

Answers

A transfer of sperm to a female

Earth's crust is a thin layer made of
a rock
b metal
c liquid metal
d water

Answers

B!!!!!!!!!!!!!!!!!!!

Answer:

a

Explanation:

State one way by which Carbon Dioxide decreases in the atmosphere

Answers

Answer:

The early atmosphere was mainly carbon dioxide and water vapour. Water vapour condensed to form the oceans. Photosynthesis caused the amount of carbon dioxide to decrease and oxygen to increase.

Hope it helps!!!

Essay Question: Which two species are more closely related?

Answers

Answer:

mannimals;humens and animals

Explanation:

Which organ is shaped like a small balloon and is located in the space between your hip bones

Answers

Answer:

bladder

Explanation:

Answer:

Bladder

Explanation:

The Bladder is shaped like a small balloon and is located in the space between your hip bones

Describe the role of (A) bacteria fixing nitrogen as they live symbiotically with some plant species, (B) nitrifying bacteria, and (C) denitrifying bacteria in the nitrogen cycle.

Answers

I think It is A what is the question?

Explanation:

Other Questions
Alejandra drove from Michigan to Colorado to visit her friend. The speed limit on the highway is 70 miles/hour. If Alejandras combined driving time for the trip was 14 hours, how many miles did Alejandra drive? Help Please !!!! Will give brain asapp The tired bus driver prepared for sleep. Where is the verb? Anthony is practicing kicking field goals for his high school football team. He knows that the field goal is 10 feet off the ground. Part A: If he stands 40 feet from the field goal, how far must he kick the ball in order to make the extra point? Part B: Explain how you arrived at your conclusion. Describe where you are in life right now. What makes you most excited about where you are now? What questions do you have, and what are you worried about? Which of the following is NOT considered a gain from trade?A. More choice for consumersB. Increases in standard of living for trading partners including improvements in education and technology availability in poorer nations.C. Increased competition which should produce an efficient allocation of scarce resources and lower prices for consumers.D. Short term loss of jobs in the economy For an open economy under a floating exchange rate regime, _________________________.a.) Monetary policy is highly effective. b.) Fiscal policy is highly effective. c.) Monetary policy is ineffective. d.) B and C. How do the nutrients in soil cause problems when erosion relocates the soil to ponds or lakes?They cause algae to reproduce rapidly causing algae blooms.They poison the microorganisms that break down dead organic matter in the ponds or lakes.They poison the fish in the ponds or lakes.They change the color of the water and reduce aquatic photosynthesis. An item that usually sells for $189 is on sale for 25% off. Find the sale price El viaje (i need it in spainsh just a paragraph!! ill mark brainlist)Write an e-mail to relative about a trip you are taking with your family this summer. Include where you are going, what the weather is going to be like, what activities you are going to do, and what clothes you are taking. Can someone please help me??????????????????? Can some please help due by 10will give brainlist to the best answerwrite an essay basicallyCentral Historical Question: To what extent should the federal government be involved in the election process?Construct an argument that addresses the Central Historical Question using knowledge of federalism, election laws, specific claims, and relevant evidence from sources.In your argument, include the following:A claim that argues what level of involvement (unlimited, limited, or no involvement) the federal government should have in the election process for the statesWhat gives or does not give the federal government permission to be involved in electionsAt least 2 historical examples to support your opinion and assertionsthank you Should we follow a popular system or the electoral college system when deciding the presidency? Sometimes, Cindy's little brother interrupts her during homework time. So, she made a triangular "Do Not Disturb" sign to hang on her bedroom door. The base of the sign is 1 1 2 feet long, and the sign is 2 2 3 feet tall. Which equation can you use to find the area of the sign, A? Select the correctly labeled subjects and verbs for the following sentences: subjects(S) and verbs(V). They brought a vegetable plate to the party. Find the surface area of the cylinder and round to the nearest tenth. Four students ran for the position of school president. Use the following results to figure out who won. Jenna received 22% of the votes. Jordan received of the votes. Kelsey received 6 out of every 20 votes. Nathan received of the votes. The winner was A Jenna B Jordan C Kelsey D Nathan Using the tree diagram and assuming that all options are equally likely, what is the probability of using sprinkles?ChooseICECREAMChooseTOPPINGnutsvanillasprinklesnutsEnter shopstrawberrysprinklesnutschocolatesprinkles A tangible way the government helps us is to _____.ensure freedoms and libertiesprovide a well-coordinated mass transportation systemprotect the right of religious freedomallow for the freedom of speech Please help! You will get 'Brainliest' if you do.