Read this excerpt from "How the World Was Made."

[Buzzard] flew all over the earth, low down near the ground, and it was still soft. When he reached the Cherokee country, he was very tired; his wings began to flap and strike the ground. Wherever they struck the earth there was a valley; whenever the wings turned upwards again, there was a mountain.

How does this incident provoke a decision in the story?

The other animals decide to call Buzzard back to Galun'lati, lest the entire world become mountainous.

Water Beetle decides to bring some mud from under the water to fill in some of the valleys Buzzard created.

The Cherokee decide to settle in the mountainous land Buzzard has created.

The other animals decide to put the sun in the sky so they can better admire what Buzzard has done.

Answers

Answer 1

Answer: The other animals decide to call Buzzard back to Galun'lati, lest the entire world become mountainous.

Explanation:

The animals used to stay in Galun'tai which was in the sky. They wanted to move to the earth which the water beetle had brought up from the ocean's bottom. The land was too wet for them though so they went back to the sky.

After some time they then sent the Great Buzzard who flew all over the earth to find land to settle. As his wings created mountains and valleys as stated in the excerpt, the animals became scared that the whole word would become mountainous so they called him back.

Answer 2

Answer:

Explanation:

it's A


Related Questions

"Alone" is about the peace and serenity that come from time alone.
- True
✅False

Answers

True hshshdhhdbsjddbhfdjshvvjdjfjfjxjsbsjd

Select the correct answer.
Is the boxed word a SUBJECT or a VERB?

His uncle flew a bomber in World War II.

A.
Subject
B.
Verb

Answers

Answer:

can you tell me what is the boxed word ?

Please I need someone who can write me a debate I will pay that person​

Answers

What do you mean a debate a debate about what?
What is it about???

Where did potuk’s father wish for potuk to be ?

Answers

Answer:

read the story

Explanation:

i can't help you with it because you didn't upload the file

what does the quote "The thing about exploring is that you have to know whether the thing you’ve found is worth finding” mean?

Answers

Answer:

It means that whatever it is that you found after exploring/searching would be worth your time and effort searching for it.

Explanation:

Hope this helps ^^

6. It is not easy to ¬¬¬¬¬¬¬¬¬¬¬¬¬¬¬¬¬¬¬¬¬______________ our bad habit.A. sufferB. spendC. overcomeD. take care

Answers

Answer:

C. Overcome

Explanation:

It is not easy to overcome our bad habit

Hope it helped you brainiest plz and thank you have a great day!!!

It is not easy to take care of our bad habit

40 points + BrainLiest

Answers

The gray, wintry day, in the first paragraph it says it all started on a gray wintry day, which suggests the fact that the gray wintry day leads to them having the conversation.

Hope this help please give the brainliest award.

In what way do u relate to tarzan or the crocodile

Answers

Answer:

eat then swim then eat then swim then eat

that what crocodiles do

Tarzan has CG hippos and crocodiles

Which of the following shows how the writer could correctly shorten the quotation?

The article I read said the following: "Author Gaston Leroux based his novel on stories he had long heard about ghosts in the opera house."

A The article I read said the following: "Author Gaston Leroux based his novel on stories about ghosts in the opera house" ...

B The article I read said the following: "Author Gaston Leroux based his novel on stories about ghosts in the opera house...."

С The article I read said the following: "Author Gaston Leroux based his novel on stories ... about ghosts in the opera house."

D The article I read said the following: "Author Gaston Leroux based his novel on stories about ghosts ... in the opera house."​​

Answers

Answer:

B.

Explanation:

B is worded correctly. For example, C and D have the three little dots which means you're finishing off the sentence which doesn't make sense. And A is not worded correctly.

This is my younger sister’s homework... we’re a bit befuddled with what they’re demonstrating here, have any ideas? It’s part of a word search! If you need to refer to the word search, please don’t hesitate to ask!

Answers

Answer:

Can you add an attachment?

Explanation:

how Qin Shihuangdi worked to unify China economically.

Answers

Explanation:

I looked it up and this was the best response I could get I hoped it helped

PLZZZZ HURRY 40 POINTS!!!!!
Use your outline to compose your argumentative text. Be sure to use a formal style and relatable diction. Offer commentary to support your reasons. Also, use effective transitions to move from one idea to the next.

Answers

The question above wants you to write an argumentative text. I can't write this text for you, but I'll show you how to write it.

First, you need to know that an argumentative text is one where you show arguments about a subject. These arguments are opinions about the subject your text addresses.

In this case, you need to choose a subject, research it and form your arguments, that is, your opinions.

After that, you can write to your text as follows:

Introduction: Quickly present the subject of your text and show your thesis statement. This thesis statement is your main arguement.

Body: Write two paragraphs, where you show other arguments that support your thesis statement. All these arguments must have textual evidence to support them. This evidence will be taken from your research.

Conclusion: Summarize all your arguments and reinforce your thesis statement by showing that it is correct.

More information:

https://brainly.com/question/17183333?referrer=searchResults

Answer:

Help?

Explanation: help?

Writw countable or uncontable next to each noun

Answers

if u ment we write their examples in countable and. uncountable that is what I shall do

Answer:

countable nouns include table ,chair ,dog ,Cat and more..uncountable nouns include water,Milk,juice,air and more..

HELP ME WITH THIS!!!

Answers

Answer:

would

Explanation:

what does it mean to get to know a narrator​

Answers

Answer:

A narrator is a person who tells a story.

Explanation:

If you know what and who a narrator is, you easily understand your question too. If you can become a close person to a narrator, he will be likely to mention you.

What’s your___________? - October 20th
A.

date of birth
B.

birth date
C.

birthday
D.

day of birth

Answers

Answer: C. birth date

How does the travelogue genre best support Marco polos purpose for writing

Answers

Answer:

C : A travelogue gives details about places and cultures that readers may not know about.

Explanation:

Where are Dennis, Mac, Jeremiah, and Anna heading to at the beginning of the text? End of the Road #7

Answers

At the beginning of the text, Dennis, Mac, Jeremiah, and Anna are heading towards Petey Coltrain's radio station.

We can arrive at this answer because:

"End of the Road," tells the story of a group of friends who end up being chased by a group of zombies.They start the story by trying to reach a radio station.One of these friends, Anna, is attacked by zombies and ends up being bitten by them.

Anna progressively becomes a zombie after the attack. Her friends are very scared of her, as they know that zombies are irrational and violent. However, Jeremiah decides to continue having contact with her while she is still human.

More information:

https://brainly.com/question/15618228?referrer=searchResults

How to write a perfect essay?

Answers

Answer:

I hope this helps!

Explanation:

1. Start by writing a thorough plan.

2. Ensure your essay has a clear structure and overall argument.

3. Try to back up each point you make with a quotation.

4. Answer the question in your introduction and conclusion but remember to be creative too.

5 difference between of epicarp and endocarp​

Answers

Answer:

Key differences between epicarp and endocarp is that, epicarp is outermost part of most of pericarp of fruit, generally represented as thin in tomato, leathery in mango, peel in banana spiky in jackfruit and membranous in coconut, and in most of case it is not edible, only provide protection whereas endocarp is thin, hard or stony and innermost part of pericarp of fruit that surrounding the seed and protect it from outer environment apart from plant protection and it is edible in tomato, almond, wood apple, etc and stony in mango. I hope this helps you.

Write a word that would belong in this group: speak, utter, verbalize, inform

Answers

Answer:

Another word that could most likely go with this is shout.

Explanation:

Answer:

announce, say, and express

Explanation:

I feel like i'm the only one who hasn't watched Squid Game

Answers

Answer:

Maybe.

Explanation:

I watched it recently, and it is probably one of my favorite TV shows now. The plot kept me interested the entire time, along with the character building. There was never really a dull moment, and everything felt like it belonged in some sense.

Every episode is close to being an hour, but it is well-worth the watch. The cinematography was executed very well, as well as the acting.

I would highly reccomend watching it if you have spare time on your hands.

Answer:

Ok

Explanation:

Please answer this questions if you all know this and if you don't know the answer, don't answer this questions:​

Answers

Answer:

.

Explanation:

Which of the following describes the author’s purpose in paragraph 1? A. to share how difficult it was to celebrate mistakes B. to show how skeptical she was of celebrating mistakes C. to share an experience in which she celebrated mistakes D. to show how she teaches her students to enjoy making mistakes

Answers

Answer:

D

Explanation:

Answer:

d as you can see

Explanation:

Activity 3. Say it Properly Let us try to use appropriate language and manner in raising our country views about the issue on "Teenage Pregnancy".

Target Audience: Students aged 13-19

Purpose: State your views about the issue

Language: Formal and simple so that the target audience can easily understand it.

Write your stand about the issue and consider the given information. Use terms that are familiar to students like you. Remember also to apply what you have learned in Lesson 1.​

Answers

The question above is intended to assess your ability to write an essay and your perception of teenage pregnancy. For that reason, I can't write the essay for you, but I'll show you how to write it.

First, you should reflect on your opinion about teenage pregnancy and the factors that contribute to this happening. You can search for this topic in articles that provide information that will help you form an opinion.

After that, you can write the essay as follows:

Introduction: Introduce the subject of your essay. Then show your opinion on the subject. That opinion is your thesis statement.

Body: Write two paragraphs. In them you will develop your thesis statement, showing the reasons that lead you to have this opinion and showing evidence, that is, data that prove that your opinion is correct. If you need to, you can write more paragraphs.

Conclusion: Show your final thoughts and strengthen your thesis statement.

More information:

https://brainly.com/question/13159899?referrer=searchResults

9. Frick decided to strike first against the union. What action did he take?

Answers

Answer:

He called in reinforcements.

When things turned personal, Frick called in the Pinkerton Detectives

Explanation:

1. Kelly Sly has given this story to her editor, who finds new mistakes—seven to be precise!
2. Can you find them all? Write the change on the lines below.
3. The capitalization, usage, punctuation, spelling, and sentence structure are correct. You need to change the
ideas in the story [revise).
you wi...
I visited the harbor on Saturday, September 31. I was after a gang of smugglers operating out of a
four-engine sailboat docked at pier 3. A quick view of the vessel showed the anchor safely pulled up. I
walked up the gangplank onto the deck and looked for somewhere to hide. A barrel full of ropes seemed
ideal, so I climbed in and waited. It wasn't long before some men appeared. "We share the loot three
ways, like we always do," said one. The others nodded sullenly. Unfortunately, I chose that moment to
Sneeze. They were onto me immediately, dragging me from the tight funnel. "A spy! Throw her
overboard!" cried the one with the black long-sleeved shirt and the tattoos on his back. "Look behind
you!" I screamed, and as they turned, I dove into the murky river. Unfortunately, the smugglers spotted
me and finished me with a fatal shot.
1
2.

Answers

Answer:

Explanation:

The capitalization, usage, punctuation, spelling, and sentence structure are correct. You need to change the ideas in the story (revise).

boys education should be more encouraged than girls education

Answers

Answer:

I partly agree with that only because I hate school

Perspectives persist in angles that open and close, and the innocence of the transparent air, through which some bird of prey crosses, while the clouds quilt the sky, and we have time to turn around to see Lake Titicaca from an even higher footing.

What does the phrase “clouds quilt the sky” mean?


The clouds make patterns.


The clouds move quickly.


The clouds interrupt the birds

The clouds obstruct the view.

Answers

Answer:

Obstructs the view

Explanation:

Because you cover you bed with a quilt and you cant see under the quilt

Hope it helps

Read the passage from “I Know Why the Caged Bird Sings.”

"I don't need to see the inside, Mrs. Henderson, I can tell . . ." But the dress was over my head and my arms were stuck in the sleeves.

What allows the reader to infer that Mrs. Flowers is concerned about Marguerite’s feelings?

Mrs. Flowers’s actions
Mrs. Flowers’s thoughts
Mrs. Flowers’s viewpoint
Mrs. Flowers’s words

Answers

Mrs flowers words her words

Answer:

Mrs. Flower's words

Explanation:

In the passage, Mrs. Flowers is telling Mrs. Henderson that she doesn't need to see the underside of the dress, but Mrs. Henderson shows her anyway. Because of what she said, the reader can infer that Mrs. Henderson is concerned about Marguerite's feelings and that she doesn't want to embarrass her.

I took the test and got 100%

Hope this helps!

Other Questions
Of the 180 students in Mrs. Stanfield's class,60% are girls On Thursday, 25% of the girls in theclasses dressed up for Wacky Tacky Day. How manygirls dressed up? Should English be capitalized in this sentence?Today I went to English class. A battery causes a current of 2.0 A to flow through a lamp. The power used by the lamp is 12 watts. What is the voltage? Which of the following is an example of intrinsic motivation?A.composing a piano tude for extra credit in your music appreciation course B.writing a song to perform at your parents' 25th anniversary party C.creating a mixed-media collage in hopes of winning a blue ribbon at a local art fair D.building a robot to enter in a competition that offers a $500 first prize Which option describes a research question? (1 point)O a question that identifies a topic that you want to learn more aboutO a question that reveals where you can find information about a topicO a question placed in the conclusion of an essay to me the reader thinka question that encourages the reader to find out more about the topicNo Which of the following characteristics of the planet, Earth, is essential tothe survival of every living organism?*Earth has abundant available water.O Earth has just one orbiting moon.O Earth orbits the Sun once every 365 days.O Earth rotates on its axis once every 24 hours. Two toy robots are turned on at the same time. The first robot beeps every 24 seconds. The second robot beeps every 36 seconds. In how many seconds will they beep at the same time? Choose only ONE best answer. 12 B 24 36 72 E 96 PLEASE HELP I ONLY HAVE AN HOUR LEFT !!!!!! please help me with this chem question!! Which phrases tell causes of suffering for blacks in northern cities after World War II? Choose all answers that are correct. Look at the net of square pyramid below l. What is the surface area? Solve by grouping 8x^3+3+6x^2+4x A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include "The blue whale is the world's largest animal. What other amazing feature isit known for?*A) Its the quietest animalB) Its the loudest animalC) Its the heaviest animalD) Its the lightest animalChoose one of them. to be useful for most household applications, DC voltage is?please Which of the following best describes Darwin's (and Wallace's) theory of evolution?Question 1 options:Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the islandThe diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection. Un coche inicia un viaje de 450 km a las ocho de la maana con una velocidad media de 90 km/h. A qu hora llegar a su destino? ASAP ONE MORE BRAINLIEST In complete Spanish sentences, answer all of the following questions on the discussion board that deal with what future profession might be good for you. 1) Como es tu personalidad? 2) Que classes te gustan? 3) Que idiomas ( languages) hablas? Which machine do you think will last longer, the traditional battery and motor, or the free energy machine?