READING CHECK
Drawing Conclusions How
does geography affect the location of economic
activities in the Western Provinces?

Answers

Answer 1

Answer:

geography is most important factor in influencing of population like* it the land is barren then no one supposed to live there because of shortage of supplies.

and western countries like England evolve in that type of geography that give them perfect place for farmers

it's the basic unit of all provinces at that time if there is no farmer then there are shortage of food


Related Questions

why thus ice getting melt​

Answers

cause heat. hot ayer. hot breath

What type of noun is the word Saturn’s​

Answers

Answer:

the type of noun for the word Saturn is a proper noun.

Answer:

The difference between a proper noun and a regular or common noun — aside from capitalization — is that proper nouns refer to a specific person, place, or thing rather than a general category. So while aquarium is a noun, SeaWorld is a particular, proper noun, and whereas planet is a noun, Saturn is a proper noun.

hope this helps

Pls help I’ll brainlest ASAP

Answers

Answer:

B

Explanation:

Which sentence from "The Circuit" most helps the reader understand that Panchito likes to learn?
O A. Suddenly I felt even more the weight of hours, days, weeks, and months of work.
B. We did not want to get in trouble for not going to school.
C. During recess I went into the rest room and opened my English book to page 125.
D. I walked up to him and asked if he could help me with the new words.

Answers

C the answer sorry if it’s not correct

classify each research source as a print or internet source

Answers

The print sources are- Austin, Rob Peterson, Evangeline Scoleville, Jason

The internet sources are- Bowerman, Katye Brown, Jackson Zlegler, Jasper

Revise this statement so it can be a good opening sentence for a paragraph:
Modern technology makes an important contribution to education by enabling students to learn
This is just for the paragraph, but the whole essay is about the good side of technology

Answers

Answer:

Modern technology is important in contributing to students learning;

Explanation:

then jus add on from there.

sumn like

Modern technology is important in contributing to students learning; for example, if modern technology didn't exist in our time era we would have had no way to continue our education when the pandemic hit. Our advanced technology today is what helped students and people all around the world to continue our education from home. This is great because it allows us to expand our minds and learn without putting our education on hold.

or sumn like that.

Question 6
READ ITI
What happens because Kylo tries to get attention instead of being a
team player?
Nico scores the winning goal,
He is not voted Most Valuable Player
Jamol becomes the team's highest scorer
His team loses to the Cougars

Answers

Explanation:

he was not voted most valuable player

what cause imamu to to stop running in the dissaperrance​

Answers

Rosa After he is acquitted of murdering a grocery store owner, Imamu Jones is released into the custody of the Aimsley family. Imamu believes that things are finally looking up--until the Aimsleys' daughter disappears and he becomes the prime suspect

(see image above)
Note:Cite the website where you got the evidence.
NO LINKS OR YOU GET REPORTED!

Answers

Answer: just look up modern technology helps students learn and use the first link.

Explanation:

Read the excerpt from Brown v. Board of Education.

We must consider public education in the light of its full development and its present place in American life throughout the Nation.

Why does the Supreme Court make this distinction?
The court recognizes that the current delivery of education might compromise citizens’ rights.
The court recognizes that the US education system has evolved over time.
The court recognizes that people in some localities are being treated unfairly by teachers.
The court recognizes that segregated schools require additional federal funding.

Answers

Answer: The court recognizes that the current delivery of education might compromise citizens’ rights.

Explanation:

Brown v. Board of Education was a Supreme Court case where it was ruled that segregation in schools was Unconstitutional. In doing so, the Court recognized that the way students were being educated could be said to be compromising the rights of citizens.

This was after the Court found out that segregated schools for blacks did not have equal facilities as those for whites which meant that they violated the 14th Amendment which states that every state must offer equal protection to people in its jurisdiction.

The court recognizes that the current delivery of education might compromise citizensrights, hence option A is correct.

What is the idea of Brown v. Board of Education?

The U.S. supreme court held unanimously in Brown v. Board of Education that racial segregation in public schools was unconstitutional under the fourteenth amendment to the Constitution.

Separate educational facilities for white and African American pupils were deemed to be fundamentally unequal in the 1954 ruling.

In the supreme court case of Brown v. Board of Education, segregation in schools was found to be unconstitutional. In doing so, the court acknowledged that it was possible to claim that the way citizens' rights were being protected in schools was being compromised.

Therefore, the court is aware that how education is now provided can compromise citizens' rights.

Learn more about Brown v. Board of Education, here:

https://brainly.com/question/30820436

#SPJ5

what makes a piece of writing poetic? full sentences

Answers

Answer:

Poetry is a type of literature based on the interplay of words and rhythm. It often employs rhyme and meter (a set of rules governing the number and arrangement of syllables in each line). In poetry, words are strung together to form sounds, images, and ideas that might be too complex or abstract to describe directly.

Explanation:

In one paragraph, using your own words, define the term observations, describe two different types of observations, and explain how observations can be helpful in a discussion.

Answers

Answer:

leave the door opennnnn

What is the order of most formal debates?

rebuttals, opposing team statement, affirmative team statement

affirmative team statement, opposing team statement, rebuttals

affirmative team statement, brief recess, opposing team statement

opposing team statement, brief recess, affirmative team statement

Answers

The order of most formal debates is affirmative team statement, opposing team statement, and rebuttals. The correct option is B.

What do you mean by a debate?

A debate is a formal discussion or argument between two or more people who present their viewpoints or arguments on a particular topic or issue. The participants of a debate are typically divided into two teams or sides, with one team arguing in favor of a proposition or statement (the affirmative team) and the other team arguing against it (the opposing team).

Debates can be structured in different ways, but typically involve a series of speeches or statements from each team, followed by rebuttals, cross-examinations, and closing statements.

The goal of a debate is to persuade the audience and judges that one side's arguments are more compelling and supported by evidence than the other side's. Debates can be held on a wide range of topics, from political and social issues to academic and philosophical debates.

There may also be additional rounds of rebuttals and cross-examinations depending on the format of the debate. A brief recess may be taken between rounds, but it is not typically part of the formal order of the debate.

Therefore, The correct order of most formal debates is Affirmative team statement, Opposing team statement, and Rebuttals.

To learn about Dictionopolis click:

brainly.com/question/27765048

#SPJ2

American families know what makes a quality child care setting. True or false

Answers

This is a mix of both.. some parents may, some may not. They should of course but there are just some people out there who weren’t raised properly and don’t know what makes a healthy family home.

WW
Activity 6. Comparative or positive degree. Use the appropriate degree of adjectives in brackets in each of
the following:
1. As computers have become.................
(advanced), their parts have become smaller and smaller
2. A supercomputer is one of the...................
(powerful) computers used for very complicated
tasks.
3. The...............
(fast) supercomputers can carry out trillions of calculations per second.
4. Unfortunately, as computer use becomes.............
(widespread) day by day, so do the
opportunities for misuse.
5. We think that computers will be.............
(fast) and............
(cheap) in the future

Answers

Answer:

1. More advanced.

2. Most powerful.

3. Fastest.

4. More widespread.

5. Faster; cheaper.

Explanation:

An adjective is one of the parts of speech in English language and it can be defined as a word that qualifies or describes a noun in a sentence. Some examples of an adjective are big, small, happy, tall, short, fat, rambunctious, etc.

In English language, there are three (3) forms of adjectives and these includes;

I. Positive adjectives: it is the simplest form of an adjective that expresses the quality of a physical object, person, place, etc., without comparison.

II. Comparative adjectives: it is used for comparing two things, person or place. Signal word such as more is used for comparison or the suffix "er" is added to the adjective.

III. Superlative adjectives: it is used to show that a person or thing has a greater degree of quality than two or more other persons or things. Thus, it is used for comparing three or more people, things, place, etc.

The proper use of comparative and superlative adjectives for this exercise are shown below;

1. As computers have become MORE ADVANCED, their parts have become smaller and smaller.

2. A supercomputer is one of the MOST POWERFUL computers used for very complicated tasks.

3. The FASTEST supercomputers can carry out trillions of calculations per second.

4. Unfortunately, as computer use becomes MORE WIDESPREAD day by day, so do the opportunities for misuse.

5. We think that computers will be FASTER and CHEAPER in the future.

Which sentence below correctly uses a comma before the quote?
Select one:

“Obama claims, looking at today’s youth, our future is bright.”


Obama claims – “looking at today’s youth, our future is bright.”


Obama claims: “looking at today’s youth, our future is bright.”


Obama claims, “Looking at today’s youth, our future is bright.”

Answers

The last one would be the only one that has the comma before the quote

05.04 A Matter of Perspective

In this lesson, we learned to watch, listen, draw conclusions, and ask questions in order to discover a character’s perspective. Now, it is your turn to do the same for a character in The Lions of Little Rock.

Directions:

Choose an event from the book that helps the reader understand Marlee’s perspective. What does she think and believe about the events and characters in the story? How do you know? Describe the event or situation in 3-5 complete sentences.



Event Description (Please include page number from the text):











Watch: What does Marlee do? How does she act? What body language and facial expressions does the author include? Provide 2 examples.

1)





2)





Listen: What does Marlee say to others? What does she say to herself that helps you understand her perspective? What do others say that help you understand the character’s perspective? Provide TWO quotations from the text.



1)



2)





Explain what your observations tell you about the character’s perspective on the situation.

Answers

Answer:

ATTENTION IF THERE IS A LINK DON'T CLICK ON IT

Explanation:

IT IS A COMPUTER, TABLET AND PHONE VIRUS

Answer:

Family was the foundation of moral society in Confucianism. Every member of a family had a proper relationship with the others, defined by age, and birth order. A minor owed the elders respect, but could also expect protection, and so, everyone was part of this system.Explanation:


This is for an elective class and I’m not sure what theme of this movie would be. I NEED HELP ASAP

What is the Theme of the movie “the heat” (2013)?
a. Good vs Evil
b. Love
c. Perseverance
d. Coming of Age
e. Justice
Human vs Nature
Human vs Machine
h. Other (What Is the theme?)

Answers

Answer:

comedy/Action

Explanation:

Anybody wanna help me out with a class and I have a lot of questions about a book called “ MONSTER “ by Walter dean . And I need help please :( let me start of by does someone know who Mr.Nipping is in the story ?

Answers

Answer:

the monster i think

Explanation:

wish I helped

Even with Mrs. Ramos’s guidance, though, the first time I baked a chocolate cake, it was less than successful. The top never rose, so I was stuck with a pancake-inspired chocolate lump. That experience, and baking in general, taught me that the little details matter. The difference between half a teaspoon and a whole teaspoon is everything in the baking world. Additionally, my first failed attempt taught me perseverance. Seeing Mrs. Ramos’s perfectly sculptured, tasty work of art piqued my interest and curiosity, and I knew that with hard work, my desserts would get there someday, too.

What does the writer hope to convey through the specific details in the passage? Check all that apply.

that his or her skills have surpassed Mrs. Ramos’s
that he or she has learned a lot about baking through failure
that failure inspires new types of cakes
that he or she appreciates the value of hard work
that some dreams are unattainable

Answers

Answer:

2 and 4 are correct

Explanation:

-that he or she has learned a lot about baking through failure

-that he or she appreciates the value of hard work

2. that he or she has learned a lot about baking through failure

4. that he or she appreciates the value of hard work

Summary for chapters 21-24 fever 1973 HELP ASP!

Answers

Answer:

Okay. This will get taken down, so I suggest you use it quickly (no I am not one of those scammers, check my profile.)

https://www.litcharts.com/lit/fever-1793/chapter-21-september-27th-1793

It will help you!

What is your own definition of “philosophy” and “teaching philosophy”? Kindly elaborate .​

Answers

Answer:

Philosophy is the study of ancient times

what does and zinkoff vanished mean

Answers

Answer:

zinkoff vanishes not himself ,of course to himself he is very much there, every minute

Explanation:

I hope this helps you sorry if it doesn’t help you.

Which of these is a motif in Frankenstein?
OA.
a haunted mansion
OB.
nightmares
OC. passive women
OD.
an ancestral curse

Answers

Answer:

C. passive women

Explanation:

plato gang

A calendar will not be helpful in planning your study schedule. Please select the best answer from the choices provided ОТ OF​

Answers

Answer:

Falsee edited 2nd time!!

Explanation:

by the way it really depends

A calendar will not be helpful in planning your study schedule. The date your Science project is due should be recorded on a daily organizer. Sometimes when people procrastinate, they do unimportant tasks before the important ones. The dates of Spring Break should be included on your weekly calendar.

Answer:

False!!!

Explanation:

by the way it really depends

A calendar will not be helpful in planning your study schedule. The date your Science project is due should be recorded on a daily organizer. Sometimes when people procrastinate, they do unimportant tasks before the important ones. The dates of Spring Break should be included on your weekly calendar.

Limerick can be defined as​

Answers

Answer:

A five-line poem written with one couplet and one triplet.

Answer:

I think the first one

Explanation:

(not 100% sure though)

7.
Which of the following is not
a a way to brainstorm for a persuasive writing topic?
using sentence starters
scanning a newspaper
looping
making a quick list

Answers

Answer:

SCanning a news paper

Explanation:

If Madeleine is doing a research project on the Grand Canyon, which personal experience should she include?
An account of her visit to the Grand Canyon
A story about canyons in Australia
A story about her grandparents who live in Arizona
How much she loves the Grand Canyon

Answers

her visit to the grand canyon

Read the sentence from a rough draft. Every kid should take a foreign language class to learn the ins and outs of a whole different culture. How could this sentence be rewritten to maintain a formal tone? Kids should really study foreign language to learn about lots of cultures. Kids: you know you want to sign up to learn a new language and culture! Students should take a bunch of classes that allow them to learn new cultures. Students should study foreign language to be exposed to new cultures.

Answers

Answer: Students should study foreign language to be exposed to new cultures.

Explanation:

The sentence can be rewritten to bring it in a formal tone is given in option (d) or (iv): " Students should study foreign language to be exposed to new cultures."

What are the benefits of learning a new language and culture?

According to research, early exposure to more than a language boosts synaptic connections, resulting in a more robust brain. In other words, it expands the brain's information channels.

Students who learn foreign languages and cultures become more responsible and engaged global citizens. It lowers the obstacles to travel, allowing people to interact more completely with others while also encouraging continuing exposure to other cultures.

Check out the link below to learn more about foreign languages;

https://brainly.com/question/20757627

#SPJ2

what are the main features of diary writing ​

Answers

Answer:

The main features of diary writing is. The diary is like a biography. So it's about your everyday life. Someone could write "Today I bought some gum". It's just a mini-biography.

Explanation:

Other Questions
A fine fabric was selling for $10.50 per half yard. Joni bought 2 1/3 yards. How much did he spend? Brainliest for correct answer. Need help plz i will give brainlyist no scammer i will report and i only have 5 min Find four arithmetic means between -8 and 17. Which statement is NOT a reason Rosa Parks was considered the right person to be the face of the Civil Rights Movement? a Rosa Parks was married and had a good job. b Rosa Parks bridged classes and was comfortable and accepted in many different social settings. c Rosa Parks had lived in Pine Level, so she was familiar with Claudette Colvins family. d Rosa Parks was an adult who was widely known in the community. e Rosa Parks was well-liked and known as level-headed in the community. Need help on his ASAP El____(ir) a la bibloteca giving brainliest *easy* Please help, test due in 2 hours! Will give good review and brainliest. Here are summary statistics for randomly selected weights of newborn girls: n=250, x_=32.9 hg, s=6.9 hg. Construct a confidence interval estimate of the mean. Use a 95% confidence level. Are these results very different from the confidence interval 31.9 hg < < 34.5 hg with only 19 sample values, x_ = 33.2hg, and s = 2.9 hg? what is the complementary DNA of TACCGGATGCCAGATCAAATC? notes of Vibrational Motion or what they are what is y=-x-4 if x=-2 Help meh plssssssss!!!!!!!! Where does Ivan Jakovlevitch findMajor Kovaloff's nose? Name and describe three types of internal medicine specialties. The base of a triangular pyramid has an area of 20 square feet. The height of the pyramid is 36 feet. The volume of the pyramid is 720 cubic feet Need answer quick please Determine if the data is biased or not biased: A shirt manufacturer wants to check quality control of their products. The plant manager decides to check every 5th shirt inspected by Inspector D. There are 15 inspectors in the plant. BiasedNot Biased 5. The following are energy releasing phase changes EXCEPTA. Condensation B. Freezing C. Deposition D. Sublimation Can someone help please