Replication, Transcription, and Translation Chart
Please answer


DNA Replication:

1。Template Strand: Start with this nucleotide chain.

TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC



2。Complementary DNA Strand: Write directly below template strand.


Transcription:

3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).



Translation:

4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).



5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).



6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).

Answers

Answer 1

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop


Related Questions

What is tantalum's electron configuration?

Answers

Answer:

Xe 4f14 5d3 6s2

Explanation:

8 As a bee feeds upon the nectar produced by a flower, the bee may become coated with the flower's pollen. As the bee flies from flower to flower, some of this pollen may contact a flower's pistil, resulting in pollination. This relationship between the bee and the flower is an example of _______.

Answers

Answer:

nector

Explanation:

G. Science:
In the following chemical reactions which are the reactants? iron+ sulphur= iron suphide.
(a): Iron and iron sulphide
(b): iron and sulphur
(c): iron, sulphur, and iron sulphide
(d): sulphur and iron sulphide

Answers

B. Iron and sulphur are the reactants. Remember the reactants are on the left hand side of the equation. The products being on the right.

what does a net ionic equation show about a reaction

Answers

Answer:

A net ionic equation shows only the chemical species that are involved in a reaction, while a complete ionic equation also includes the spectator ions.

Brainlist pls!

Richard and Brooke's teacher tells them to place 30 marbles in an 8-inch
baking pan to make a model. She tells them that each marble represents
a water molecule in the liquid state. Then she asks them to move their
model to show what happens to the liquid water molecules when heat is
added. What do Richard and Brooke do to show this?
They spread the marbles to the edges with their hands.
They tilt the pan so the marbles move to one side of the pan.
They push the marbles to the center of the pan with their hands
They gently shake the pan causing the marbles to move back and forth.

Answers

Answer:

The correct answer is - They gently shake the pan causing the marbles to move back and forth.

Explanation:

When water is heated the molecules present in its liquid state start to move and vibrate faster and allows the water to expand and increase in volume. If the heat is continuously applied to the water its molecules move even faster and escape in the form of molecules of vapor to the atmosphere.

To exhibit this phenomenon by the marble and pan, Richard and Brooke should gently shake the pan causing the marbles to move back and forth which shows faster vibration and movement of molecules.

Aluminum metal reacts with aqueous nickel(II) sulfate to produce aqueous aluminum sulfate and nickel as a precipitate. In this reaction 108 g of aluminum were combined with 464 g of nickel(II) sulfate to produce 274 g of aluminum sulfate.

Answers

The question is incomplete, the complete question is;

In this stoichiometry problem, determine the percentage yield:

Excess aluminum metal reacts with aqueous nickel(II) sulfate to produce aqueous aluminum sulfate and nickel as a precipitate. In this reaction 108 g of aluminum were combined with 464 g of nickel(II) sulfate to produce 274 g of aluminum sulfate.

Answer:

80%

Explanation:

The reaction equation is;

2Al(s) + 3NiSO4(aq) --------> Al2(SO4)3 + 3Ni(s)

Since Al is in excess then NiSO4 is the limiting reactant.

Number of moles in 464 g of NiSO4 = mass/ molar mass

Molar mass of NiSO4 = 155 g/mol

Number of moles = 464g/155g/mol = 2.99 moles

Number of moles of Al2(SO4)3 = mass/molar mass

molar mass = 342 g/mol

Number of moles = 274g/342g/mol = 0.8 moles

From the reaction equation;

3 moles of NiSO4 yields 1 mole of Al2(SO4)3

2.99 moles of NiSO4 yields 2.99 * 1/3 = 1 mole of Al2(SO4)3

% yield = actual yield/ theoretical yield * 100/1

actual yield =  0.8 moles of Al2(SO4)3

Theoretical yield = 1 mole of Al2(SO4)3

% yield = 0.8/1 * 100 = 80%

In this exercise we have to use the knowledge of reaction to calculate the required percentage, in this way we find that:

[tex]80\%[/tex]

The reaction equation is;

[tex]2Al(s) + 3NiSO_4(aq) \rightarrow Al_2(SO_4)_3 + 3Ni(s)[/tex]

Since Al is in excess then NiSO4 is the limiting reactant. Now knowing that the data informed is:

Number of moles in 464 g of NiSO4  Molar mass of NiSO4 = 155 g/mol Number of moles = 2.99 moles Number of moles of Al2(SO4)3 Molar mass = 342 g/mol Number of moles = 0.8 moles

From the reaction equation;

[tex]\% yield = actual\ yield/ theoretical\ yield * 100/1\\\% yield = 0.8/1 * 100 = 80%[/tex]

See more about reaction at brainly.com/question/3664113

The formula StartFraction actual yield over theoretical yield EndFraction. is used to calculate the ____ yield of a reaction.

Answers

Answer:

Percentage yield

Explanation:

The formula given in question above is used to calculate the percentage yield.

The percentage yield of a given reaction is defined as the value obtained in percent by comparing the actual and theoretical yield together. It can be obtained by using the following formula:

Percentage yield = (Actual / Theoretical) × 100

Where:

The actual yield is the mass obtained from the experiment. The theoretical yield is the mass obtained from the stoichiometric calculations.

Learn more about percentage yield: https://brainly.com/question/25910524

Which statement describes the Arrhenius interpretation of acids and bases?
It has a wider range of applications than the Bronsted-Lowry interpretation.
It has a wider range of applications than the Lewis and Bronsted-Lowry interpretations.
It is used in situations that involve bases that do not produce hydroxide ions.
It is limited to situations that involve aqueous solutions or specific compounds.

Answers

Answer:

D. It is limited to situations that involve aqueous solutions or specific compounds.

Explanation:

It is the only interpretation that involves specifically aqueous solutions.

The statement that describe Arrhneius interpretation of acids and bases is It is limited to situations that involve aqueous solutions or specific compounds.

Arrhenius interpretations of acids and bases.

Svante Arrhenius a swedish scientist formulated a theory about acid and bases in 1884 based on theory of ionization. Arrhenius stated that acids contains hydrogen ions and when its dissociates in water will give out H+ ions and base is an hydroxide substances that will produce OH− ions on when it dissociates in water.

Therefore, The statement that describe Arrhneius interpretation of acids and bases is It is limited to situations that involve aqueous solutions or specific compounds.

Learn more about Arrhneius interpretation of acids and bases

https://brainly.com/question/12341961

#SPJ5

12. Which one of the following is not true about the reaction of: CH3-CH3+Cl2...CH3CH2Cl+HCl? * *

it is elimination reaction
it is photochemical reaction
it is chlorination reaction
it is substitution reaction

Answers

Answer:

it is elimination reaction

Explanation:

Because substitution takes place not elimination

nonmetallic elements form ions by ____________

valence electrons to complete their outer shell.


gaining or losing?

Answers

Answer:

you know it is what it is☠

Explanation:

Nonmetallic elements form ions by valence electrons to complete their outer shell. The valence electrons an element has in its outer shell, the easier it is to complete. The electron shells an element has, the easier it is to fill its outermost shell.

HELP PLEAAAAAAASE!!!!!
As the radius of a star increases, how do you think its luminosity might change?

Answers

Brighter stars have a larger radius

What is the gram formula mass of K?

Answers

Answer:

6.4924249 × 10^-23 g you need to solve it

How many moles of H2O are formed from the combustion of 5.0 mol CH4

Answers

Question:

How many moles of H2O are formed from the combustion of 5.0 mol CH4

Answer:

For any balanced chemical reaction, whole numbers (coefficients) are used to show the quantities (generally in moles ) of both the reactants and products. For example, when oxygen and hydrogen react to produce water, one mole of oxygen reacts with two moles of hydrogen to produce two moles of water.

(HELP FAST )What occurs when a pure liquid substance is cooled?

Answers

Answer:

The particles in the substance become less active

the second choice, The particles in the substance become less active

How much energy does it take to freeze 30.0g of H2O at 0 oC?

Answers

Energy to freeze : 10020 J

Further explanation

Given

mass of H₂O = 30 g

Required

Energy to freeze

Solution

Reaction

H₂O(l) ⇒  H₂O(s)

The heat to change the phase can be formulated :

Q = mLf (melting/freezing)

Lf = latent heat of fusion (for water/ice = 334 J/g)

Then heat to freeze :

[tex]\tt Q= 30\times 334=10020~J[/tex]

Give reasons:
(a) Winding roads are made on hills.​

Answers

Answer:

Mountainous roads are winding and gently sloping in order to reduce the effect of steepness which causes more downward gravitational pull to the vehicles on it. A steeper sloped road would slow the car down to a greater extent that an gently sloping one.

Microwave radiation has a wavelength on the order of 1.0 cm. Calculate the frequency and the energy of a single photon of this radiation. Calculate the energy of an Avogadro's number of photons (called as einstein) of this radiation.

Answers

Given that,

The wavelength of microwave radiation = 1 cm = 0.01 m

To find,

The frequency and the energy of a single photon of this radiation.

Solution,

Let f be the frequency of the wave. The relation between frequency and wavelength is given by :

[tex]f=\dfrac{c}{\lambda}\\\\f=\dfrac{3\times 10^8}{0.01}\\\\=3\times 10^{10}\ Hz[/tex]

Let E be the energy of the wave. The energy of the wave is given by :

[tex]E=hf\\\\=6.63\times 10^{-34}\times 3\times 10^{10}\\\\=1.98\times 10^{-23}\ J[/tex]

We know that, [tex]N_A=6.022\times 10^{23}\ \text{photons/mol}[/tex]

Energy :

[tex]E={1.98\times 10^{-23}}\times {6.023\times 10^{23}}\\\\=11.92\ J/mol[/tex]

Hence, this is the required solution.

The carbon atom has six total electrons in two energy levels. How many will be in each
level?

Answers

Answer:

5

Explanation:

Answer:

2 in the first and 4 in the second

Explanation:

in an atom the first energy level has only 2 spaces for electrons, as the number electrons goes up so does the amount of energy levels

what geologic process directly forms beaches on the shores of the bay?

Answers

A beach forms when waves deposit sand and gravel along the shoreline. . This can undercut cliffs causing large sections of rock and sediment to fall into the water. Tides are the daily or twice-daily rise and fall of the oceans.

The geologic process that directly forms beaches on the shores of the bay should be considered as the sediment deposition.

What is sediment deposition?

The Deposition refer to the laying down of sediment that should be carried by wind, where the water should be flowing down or there is the sea or ice. Sediment could be transported just like the pebbles, sand ,and mud, or as salts mix in the water.

Therefore, The geologic process that directly forms beaches on the shores of the bay should be considered as the sediment deposition.

Learn more about geologic here: https://brainly.com/question/3101097

If energy absorbed is greater than energy emitted does temperature increase or decrease?

Answers

Answer:

the decrease is the answer to the question

A student found the percent composition of CO to be 50% C and 50% O. What did the student do Incorrectly? What is the percent composition of CO?

Answers

Answer:

O = 57.14%

C = 42.86%

Explanation:

First of all we will calculate the molar mass of CO.

C = 12 g/mol

O = 16 g/mol

CO = 12 g/mol + 16 g/mol

CO = 28 g/mol

Percent composition:

C = (12 g/mol  /28 g/mol ) × 100

C = 42.86%

O = (16 g/mol  /28 g/mol ) × 100

O = 57.14%

Answer:

it should be 42.86% carbon and 57.14% oxygen

C = 12

O = 16

CO = 12 + 16

CO = 28

C = (12 /28 ) × 100

C = 42.86%

O = (16  /28 ) × 100

O = 57.14%

A can of cola contains approximately 240 calories. If you consume two cans of cola each day for one week, approximately how many calories did you consume from cola?
Select one:
a)3,400 calories
b)70 calories
c)1,700 calories
d)480 calories

Answers

Answer:

[tex]\boxed{\pink{\sf Option \ (a) \ is \ Correct .}}[/tex]

Explanation:

Given that , A can of cola contains approximately 240 calories. And we consume two cans of cola each day. So , calories consumed in one day

[tex] = 2 \times 240 calories \\\\= 480 calories [/tex]

In a week there are seven days. So calories consumed in a week

[tex]= 7 \times 480 calories \\\\= 3360 calories [/tex]

Which is approximately equal to 3,400 calories.

Hence option (a) is correct .

where is the mass of an atom located?

Answers

The mass is located in the necleus.

What is the volume of a flask that contains 0.730 moles of Nitrogen at a pressure of 698 mmHg and a temperature of 35.4°C?

Answers

Answer:

V = 20.1 L

Explanation:

Given data:

Volume of flask = ?

Number of moles of nitrogen gas = 0.730 mol

Pressure = 698 mmHg (698/760 = 0.92 atm)

Temperature = 35.4°C

Solution:

The given problem will be solve by using general gas equation,

PV = nRT

P= Pressure

V = volume

n = number of moles

R = general gas constant = 0.0821 atm.L/ mol.K  

T = temperature in kelvin

Now we will convert the temperature.

35.4+273 = 308.4 K

by putting values,

0.92 atm× V = 0.730 mol ×0.0821 atm.L/ mol.K × 308.4 K

V = 18.48 atm.L / 0.92 atm

V = 20.1 L

What is a reduction reaction?

A. A reaction in which an atom forms a new isotope by gaining neutrons.
B. A reaction in which charged particles form an ionic compound.
C. A reaction in which negatively charged particles are in the products.
D. A reaction in which an atom has gained 1 or more electrons.

Answers

Answer:

D. A reaction in which an atom has gained 1 or more electrons.

Explanation:

The oxidation reduction reactions are called redox reaction. These reactions are take place by gaining or losing the electrons and oxidation state of elements are changed.

Oxidation:

Oxidation involve the removal of electrons and oxidation state of atom of an element is increased.

Reduction:

Reduction involve the gain of electron and oxidation number is decreased.

Consider the following reactions.

4KI + 2CuCl₂  →   2CuI  + I₂  + 4KCl

The oxidation state of copper is changed from +2 to +1 so copper get reduced by gaining the one more electron

True or false.  As a wave travels through a given material its velocity changes.

Answers

Answer:

true

Explanation:

Answer:

false

Explanation:

i took the test and got it right

please its urgent! 8P4 + 3S8 -> 8P4S3

The molar masses of the substances are as follows: P4 = 123.895g/mol, S8 = 256g/mol, P4S3 = 220.093g/mol

If 20.0g of P4 and 40.0g of S8 are combined, what is the amount of P4S3 produced in moles?

Answers

Answer:

The amount of P₄S₃ produced is 0.16 moles.

Explanation:

The balanced reaction is:

8 P₄ + 3 S₈ → 8 P₄S₃

By stoichiometry of the reaction (that is, the relationship between the amount of reagents and products in a chemical reaction), the following amounts of each compound participate:

P₄: 8 moles S₈: 3 moles P₄S₃: 8 moles

Being the molar mass of each compound:

P₄:  123.895 g/molS₈: 256 g/mol P₄S₃: 220.093 g/mol

then by stoichiometry of the reaction, the following amounts of reactant and product participate in the reaction:

P₄:  8 moles* 123.895 g/mol= 991.16 gS₈: 3 moles* 256 g/mol= 768 gP₄S₃: 8 moles* 220.093 g/mol= 1,760.744 g

The limiting reagent is one that is consumed first in its entirety, determining the amount of product in the reaction. When the limiting reagent is finished, the chemical reaction will stop.

In this case, you calculate the limiting reactant using the following rule of three: if by stoichiometry 768 g of S₈ react with 991.16 g of P₄, 40 g of S₈ with how much mass of P₄ will it react?

[tex]mass of P_{4}=\frac{40 grams of S_{8} *991.16 grams of P_{4} }{768 grams of S_{8}}[/tex]

mass of P₄= 51.62 grams

But 51.62 grams of P₄ are not available, 20 grams are available. Since you have less mass than you need to react with 40 grams of S₈, P₄ will be the limiting reagent.

Then you can apply the following rule of three: if by stoichiometry 991.16 grams of P₄ form 8 moles of P₄S₃, 20 grams of P₄ will form how many moles of P₄S₃?

[tex]moles of P_{4} S_{3}=\frac{20 grams of P_{4} *8 moles ofP_{4} S_{3} }{991.16 grams of P_{4}}[/tex]

moles of P₄S₃= 0.16

The amount of P₄S₃ produced is 0.16 moles.

In the reaction 2Na+ Cl2 + 2NaCl, the products are O half the reactants. twice the reactants. the same as the reactants. o different from the reactants.​

Answers

Answer:

It should be the same as the reactants. Because there is no loss or replacements.

Explanation:

Answer:

The same as the reactants

Explanation:

Name the three stress forces that cause changes in Earths crust. Explain how each type of force affects rock.Identify the type of fault that each force produces. This is science i couldnt find a science thing

Answers

Answer:

Shear

Tension

Compression

Explanation:

The 3 stress forces are;

-shear

-tension

-compression

1) Shear is the stress force that pushes back a mass of rock in two opposite directions which in turn will produce strike - slip faults.

2) Tension is the stress force that pulls on the crust thereby stretching in a manner that it becomes thinner at its middle which in turn will produce normal faults.

3) Compression is the stress force that makes rocks squeeze until they fold or break and this will in turn produce reverse faults.

1. Air contains mostly nitrogen (78%) and oxygen (21%). It also contains other gases, including carbon dioxide and helium, and various pollutants (both gases and solids). Write a brief explanation about why air is a mixture, whether it is homogeneous or heterogeneous, and how it can be separated into its components.

Answers

Answer:

It also contains other gases, including carbon dioxide and helium, and various pollutants (both gases and solids).

Other Questions
who is the first lady president of nepal ? help me out bruv it is due by the endof week As an allied health worker, the single most important thing you can do to prevent the spread of disease is When using variable costing, costs are grouped by each of the following (select all answers that are applicable):___________a) functionb) variablec) fixedd) production Which of the following thinkers was a notable scholastic?Roger BaconThomas AquinasGalenAristotle Which system collects "trash" from the body and also helps with fighting invading bacteria and viruses?Group of answer choicesintegumentarynervousskeletalimmune When a country chooses to limit the kinds of goods or services it produces, it is practicingabsolute advantage.globalization.dependency specialization What does Rashads father want Rashad to understand about Police Officers? Your users are reporting latency in your services. Traditionally with on premise architecture, you would have to page your admin so she could launch another server to balance the load on your servers. How can you automate this with AWS place the following in least to greatest (photo for more) Identify the linear coefficient of the product(7x- 4) (3x + 11) The era of group migration lasted between 1820 and 1880. Which country experienced a major potato famine and sent the most settlers during this era?A.IrelandB.ChinaC.ItalyD.GermanyPlease select the best answer from the choices providedABCD Joes family has completed 60% of a trip. They have traveled 30 miles.How far is the trip? A trade school would like to measure the long-term success of its graduates after they leave the school, and emails a survey requesting information from graduates about their work experience. One question asks graduates if they are currently employed in the field they studied in school, while another asks them to share their annual salary. What type of bias is most likely to be present in the survey results?This is response bias because some graduates may not provide accurate information.This is question wording bias because many graduates may misunderstand the questions asked.This is voluntary response bias because graduates may choose to be part of the sample.This is nonresponse bias because many graduates may choose not to respond to the email survey. the football team has 4 freshman, 7 sophomores, 10 juniors, and 15 seniors. two players will be chosen at random to participate in a coin toss. what is the probability that both players chosen will be sophomores? Select all polynomials that have (x 2) as a factor.Choose all answers that apply:A(x) = x^3 + x^2 + 4B(x) = x^3 x 6C(x) = x^4- 3x - 10D(x) = x^4 2x^3 2 Complete the square 8-2x^2 For a parking payment app, what option would MOST likely connect a user to a third party/external gateway? a"Sign In" b"Rates" c"Pay" d"Time remaining" in the dihybrid cross for pea plants shown below, ris dominant for round peas, ris recessive for wrinkled peas, y is dominant for yellow peas, and y is recessive for green peas. a student could accurately make which statements about the offspring of this crossA. There is a 50% chance of having round, yellow peasB. There is no chance of having round, yellow peasC. There is a 100% chance of having round, green peasD. There is no chance of having any wrinkled, green peas What are 2 examples of epithelial tissue Steam Workshop Downloader