Rewrite 2/9 + 5/12 with a common denominator

Answers

Answer 1
8/36 and 15/36,, common factor is 36.

36 divided by 9 times 2 is 8
36 divided by 12 times 5 is 15

Related Questions

2+31×1/10+14×1/100 is greater smaller or equal to 2.324 and 14+72×1/10+4×1/1000 is greater than smaller than or equal to 21.24 and 0.3×10 to the second power +0.007×10 to the third power is bigger than small that are equal to 0.3×10+0.7×10 to the second power

Answers

Answer:

3457

Step-by-step explanation:670

please help with #2 and #4

Answers

Answer:

Problem 2: k = 3

Problem 4: NO SOLUTION

Step-by-step explanation:

Problem 2 work:

-4/3(12k + 27) = -57 - 9k

-16k - 36 = -57 - 9k    -ADD THE -9k TO ITSELF AND TO -16k-

-7k - 36 = -57     -ADD THE -36 TO ITSELF AND -57-

-7k = -21

k = 3

Problem 4 work:

5/2(6w - 16) = 18w -(3w + 40)

15w - 40 = 18w - 3w - 40    -ADD THE -3w TO THE 18w-

15w - 40 = 15w - 40

NO SOLUTION BECAUSE BOTH SIDES ARE THE SAME

Answer:

5;:':;;gighifighfutfdyfuhufgfyhxfkcy

John's phone bills for the last five months are $24.71, $22.13, $19.87, $27.33, and $26.76.
Find John's mean phone bill over this period.

Answers

Answer:

$24.16

Step-by-step explanation:

Someone please help on this problem

Answers

Answer:

b

Step-by-step explanation:

f(x)=3x²-4x+2, what is f(-5), show work​

Answers

Given f (x) = 3x^2 - 4x + 2; What is f (-5)

f (-5) = 3x^2 - 4x + 2

f (-5) = 3(-5)^2 - 4(-5) + 2

f (-5) = 3(25) - 4(-5) + 2

f (-5) = 75 + 20 + 2

f (-5) = 97

or

( -5 , 97 )

Examine the Federal Tax Table for married couples filing joint returns.

Married Couples Filing Jointly
If Taxable Income Is between: Then the Tax Due Is:
$0 – $19,400 10% of taxable income
$19,401 – $78,950 $1940+12% of the amount over $19,400
$78,951 – $168,400 $9086+22% of the amount over $78,950
$168,401 – $321,450 $28,765+24% of the amount over $168,400
$321,451 – $408,200 $65,497+32% of the amount over $321,450
$408,201 – $612,350 $93,257+35% of the amount over $408,200
$612,351+ $164,709.50+37% of the amount over $612,350



Sally and her husband, Ahmed, together earned a total of $203,300 in taxable income last year. Using the tax table, what do they owe in federal income taxes? Enter your answer rounded to the nearest dollar, such as: $42,536

Answers

Answer:

  $37,141

Step-by-step explanation:

The applicable line of the tax table is ...

  $28,765+24% of the amount over $168,400

If A represents the amount of taxable income, this simplifies to ...

  $28,765 +0.24(A - 168,400) = $28,765 +0.24A -40416 = 0.24A -$11,651

For their income of 203,300, Sally and Ahmed owe ...

  0.24×203300 -11651 = 48792 -11651 = 37141

They owe $37,141.

Select the best answer for the question.
11. Which of the following is a mixed number?
O A.25
O B.5/2
C. 2.3
O D.2/ 1/2

Answers

Answer:

c

Step-by-step explanation:

what is the psychology of a middle school student compared to a elementary compared to a high school compared to a college how does the brain change

Answers

Our brain's capacity increases day by day with respect to our growth of our bodyAs older the student be the sharper theirs brain becomes.A middle school student has a less equipped brain capable to handle their studies.But a hugh school student has more sharper brain than the middle school student.

WILL MARK BRAINLIEST REAL ANSWERS ONLY

Mark can read 20 pages of a book in 1 hour. His school assignment is to da 260 page book. Track how many hours he has left to read. Number of Pages left hours to read. What is the unit rate? And write an equation for the line. (also please help me graph it)​

Answers

Answer:

for the table

x y

0 260

1 240

2 220

3 200

Unit Rate is -20

we know this because the question tells us, he reads 20 pages per hour

the equation would be

y = -20x + 260

What is the y-intercept of the graph below.​

Answers

The y-intercept is 0, as that is where the line go thorugh the y-axis line.

Hey ! Can anyone help me with this question please ? Thank you

Answers

Answer:

x = 102°

Step-by-step explanation:

a straight line = 180°

180 - 78° = 102°

Answer:

x°+78°=180°[supplementry angle]

x°=180°-78°

x°=102°

answer

If a patient takes 60 mg of medication three times a day how many grams will the patient take in four days?

Answers

9514 1404 393

Answer:

  0.720 grams

Step-by-step explanation:

The total number of doses in the 4-day period is ...

  (3 doses/day)(4 days) = 12 doses

At 0.060 g/dose, the total number of grams is ...

  (0.060 g/dose)(12 doses) = 0.720 grams . . . in 4 days

Which data set has the same standard deviation as the data set {2,2,5,6,8}?

A. {3,4,4,7,7}
B.{5,6,5,6,5}
C.{3,3,6,7,9}
D.{4,4,5,5,5}

Answers

Answer:

C

Step-by-step explanation:

Answer:

c

Step-by-step explanation:

Anybody a expert or really good at social studies cuz I really need that help answer ASAP

Answers

bbc because its super big like super big

Step-by-step explanation:

Ansie bought 2 bags with 10 bows and 3
bags with 14 bows. She used 23 of the
bows on graduation gifts she wrapped.
Write an equation can be used to solve for
b, the number of bows Ansie has left?

Answers

10 bows + 14 bows= 24 bows.

24-23= 1

Ansie has 1 bow left.

81 is what percent of 90?​

Answers

Answer:

72.9

Step-by-step explanation:

hope it helps you out

please mark brainiest

Answer:

81 Out of 90 is 90%.

Step-by-step explanation:

Follow the below steps to calculate what percent is 81 out of 90 or how to write 81/90 as a percentage.

Step 1: Percentage Formula = Number1/Number2 x 100

Step 2: plugin the 81 and 90 to the percentage formula and we get 81/90 x 100 = 90%

hope this helps!

(can u mark brainliest)

the star bakery they made 112 loaves of bread on monday. on tuesday they made twice as much as they made monday. how many loaves of bread did they make tuesday. answer

Answers

Answer:

224

Step-by-step explanation:

112 x 2 = 224

Someone please HELP!!!
I’ll make it brainliest

Answers

Answer:

Step-by-step explanation:

Question 1) Take each point and move down two units. For example: Take point A, keeping it on the vertical line, and count two squares down, then place a new point there and call it A1. Do the same for each point in the parallelogram. Question 2) Take one point from parallelogram EFGH and move it two squares to the left. Then from that new point, count four squares down and place a new dot there. Do this for every point in the EFGH parallelogram. Question 3) This one is a bit trickier. Ok, so we know three points on the graph. L(-5, -5), M(-5, -2), and N(-2, -2). Ok so we know that if we plot these points, they will make three points in a square. All we need is the fourth point. To get that, we have to place all three points on the graph. Let's start with L. The coordinates are (-5, -5). Now, the first number is -5 which means to go 5 points to the left from the center point, then the next number is -5 again, so that means that from that point that we just made, you go 5 points down, and then that is your point L. Now, for point M, it is the same thing except for the second number, it tells us to go -2. So, instead of going 5 down like the first point, you must go 2 points down after you have to the left 5 points. REMEMBER: when plotting points, you always have o start in the center point(center of the graph). Negative numbers are always left and down. Positive numbers are always right and up. Do the same thing for point N (left 2, and then 2 down). After you have plotted all three of these points, you can see that there is one point missing. The point that we are missing is (-2, -5) (2 to the left, and 5 down).Question 4) Ok, so what you want to do is first plot your points. X(2, 1): start at center point and go 2 points to the right and one point up. Y(4,4): from center point, o 4 points to the right and the 4 points up. Z(5,2): from center point, go 5 points to the right then 2 points up. Now, connect your dots and it should make a triangle. Now for the tricky part. They want us to move our triangle 4 points down. So, start with letter Y and simply count 4 points down from its original point and place the new dot there. The new coordinates to this new Y point should be: (4, 0) (4 to the right of the center point and 0 up or down) So, this point should be on the line. The reason it is still 4 to the right is because all we did was move the point down and not left or right. DO this with the other two points and you should get: X(2, -3) (2 to the right and 3 down from center point) and Z(5, 2) (5 to the right and 2 down from center point)Question 5) THE FIRST NUMBER IS ALWAS THE NUMBER ON THE HORIZONTAL LINE.

I. the point is is moved 4 to the right of the center point and 2 down. So it is (4, -2)

P. This point is moved negative 4 (to the left) and down 3 . So it is: (-4, -3)

G. This point is moved 5 to the right and then up 2 which makes it (5, 2)

Q.  This point is moved 6 to the right and 4 down which makes it (6, -4)

R. This point is moved 2 to the left and 2 up which makes it (-2, 2)

S. (6, 4)

J. (-2, -4)

U. (-5, 0)

H. (3, -1)

K. (-6, -5)

12) Armani gets paid $9 an hour to paint. If he works for
5 12 hours, how much money will he make?

Answers

Answer:

multiply 9*512= 4,608

Step-by-step explanation:

$540 should be the answer!

how do i know my answer is reasonable

Answers

You may know your answer is reasonable if you can fact check it and get your answer or something very similar or in math, by checking your work.

9•(c + 3) = 9•c +9•3

Choose the property of real numbers that justifies the equation

Answers

Answer: Distributive Law

Which values are solutions to the inequality below? Check all that apply.
a > 16



Someone I need help!!

Answers

Answer:

1000 and 3000

Step-by-step explanation:

si a+b = 40; ab= 40 calcula a2 + b2

Answers

a² + b² = 1,520

Step-by-step explanation:

a + b = 40ab = 40

a² + b²

= (a + b)² - 2ab

= 40² - 2(40)

= 1,600 - 80

= 1,520

Danny had friends over to watch a football game last night. He served spicy cheese dip as an
appetizer. First, he melted cheese in a pot. He split the cheese, putting the same amount into
two serving bowls. Then, Danny mixed spicy peppers into each bowl. He put fewer spicy
peppers in the second bowl. Which cheese dip was spicier?



Answer : the first bowl

Answers

Answer:the first bowl

Step-by-step explanation:

The first bowl is the answer :)

Translate each graph as specified below.
(a) The graph of y=f(x) is shown. Translate it to get the graph of y=f(x) - 4.
(b) The graph of y=g(x) is shown. Translate it to get the graph of y=g(x - 2).

Answers

Answer:

1

Step-by-step explanation:

1

The answers are :

a) The graph is translated downwards by 4 units.

b) The graph is translated downwards by 2 units.

What do you mean by translation of a graph ?

The modification of an existing graph or graphed equation to create a different version of the following graph is known as translation.

a)

The graph of y = f(x) is shown.

The other function is y = f(x) - 4.

As it can be observed that the graph is translated from its parent function which is y = f(x) to function y = f(x) - 4.

The graph is shifted down by 4 units or translated downwards by 4 units.

b)

Here , the graph of y = g(x) is shown.

The other function is y = g(x -2)

As we can observe that the graph is translated from its parent function which is y = g(x) to function y = g(x - 2).

The graph is shifted downwards by 2 units or translated downwards by 2 units.

Therefore , the answers are :

a) The graph is translated downwards by 4 units.

b) The graph is translated downwards by 2 units.

Learn more about translation here :

https://brainly.com/question/12861087

#SPJ2

PLEASE HELP!!! WILL GIVE BRAINLIEST!!!!!

Answers

1. Unique solution
3.Infinite solutions
2. No solution
4. No solution
5. 7x+12=7x-3
6. 7x + 12 = 12 + 7x
7. 7x + 12 = 4x + 3

What is the slope of A line parallel to the line whose equation is 6x+9y=216

Answers

The slope is -2/3x hope this helped


For v = -3(r - 3) when r= -1, what does v equal

Answers

Answer: 12

Step-by-step explanation:

v = -3(-1-3)

v= -3(-4)

v= 12

What is 12*12 in active numbers?

Answers

12 times 12 is 144 :)

Answer:

144

Step-by-step explanation:

12x12= 144

A plant was 4/5 meters tall. Then 1/2 meter was cut off. When the height of the plant was last measured it had grown back ​1/10​ meter. What was the height of the plant when it was last measured?

i need this quick plz

Answers

The new height of the plant when it was last measured is [tex]\frac{2}{5}cm[/tex] tall

The initial height of the plant is 4/5 meters tall

If 1/2 meter was cut off, hence the new height of the plant will be expressed as;

[tex]N_h=\frac{4}{5} -\frac{1}{2}\\N_h=\frac{2(4)+5}{10}\\N_h=\frac{8-5}{10}\\N_h=\frac{3}{10}[/tex]

Hence the new height is 3/10

If the height of the plant when last measured had grown back ​1/10​ meter, the height was last measured is expressed as [tex]\frac{3}{10}+ \frac{1}{10}= \frac{4}{10}=\frac{2}{5}[/tex]

Hence the height of the plant when it was last measured is [tex]\frac{2}{5}cm[/tex] tall

Learn more here: https://brainly.com/question/23182815

The new height of the plant when it was last measured is  tall

The initial height of the plant is 4/5 meters tall

If 1/2 meter was cut off, hence the new height of the plant will be expressed as;

Hence the new height is 3/10

If the height of the plant when last measured had grown back ​1/10​ meter, the height was last measured is expressed as

Hence the height of the plant when it was last measured is  2/5 tall

Other Questions
If the vehiche has a speed of 24.0 m/s at point a what is the force of the track on the vehicle at this point? Removing Shingles from a roof is called aO tear OffO Removing ShinglesO Shingle ReplacementO Remodeling roofing what do you think is the meaning of road rage? A fine fabric was selling for $10.50 per half yard. Joni bought 2 1/3 yards. How much did he spend? Brainliest for correct answer. Need help plz i will give brainlyist no scammer i will report and i only have 5 min Find four arithmetic means between -8 and 17. Which statement is NOT a reason Rosa Parks was considered the right person to be the face of the Civil Rights Movement? a Rosa Parks was married and had a good job. b Rosa Parks bridged classes and was comfortable and accepted in many different social settings. c Rosa Parks had lived in Pine Level, so she was familiar with Claudette Colvins family. d Rosa Parks was an adult who was widely known in the community. e Rosa Parks was well-liked and known as level-headed in the community. Need help on his ASAP El____(ir) a la bibloteca giving brainliest *easy* Please help, test due in 2 hours! Will give good review and brainliest. Here are summary statistics for randomly selected weights of newborn girls: n=250, x_=32.9 hg, s=6.9 hg. Construct a confidence interval estimate of the mean. Use a 95% confidence level. Are these results very different from the confidence interval 31.9 hg < < 34.5 hg with only 19 sample values, x_ = 33.2hg, and s = 2.9 hg? what is the complementary DNA of TACCGGATGCCAGATCAAATC? notes of Vibrational Motion or what they are what is y=-x-4 if x=-2 Help meh plssssssss!!!!!!!! Where does Ivan Jakovlevitch findMajor Kovaloff's nose? Name and describe three types of internal medicine specialties. The base of a triangular pyramid has an area of 20 square feet. The height of the pyramid is 36 feet. The volume of the pyramid is 720 cubic feet Need answer quick please Steam Workshop Downloader