what are 3 fun interesting facts about women in world war 1

Answers

Answer 1

Answer:

1. Women took on new roles in the work force, notably in war production and agriculture.

2. In 1914, the German armaments producer Krupp employed almost no women.

3. By 1917, women made up nearly 30 percent of its 175,000 workers and a nationwide total of nearly 1.4 million German women were employed in the war labor force.

Explanation:

Answer 2

Answer:

they where only useful for cooking, cleaning, and they brung men supplies for war.

Explanation:


Related Questions

which psychological horror film was based on a novel by stephen king?

Answers

Answer: Misery

Explanation: the film was adapted from the novel, Misery by Stephen King. It includes psychological and horror/thriller elements within the story and was adapted into a movie in 1990.

The psychological horror film that was based on a novel by Stephen King is known as Misery.

Misery is a movie that was released in 1990.

Rob Reiner directed the movie.

This novel by Stephen King is also titled Misery.

Some of the actors and actresses of the movie are:

James Caan as Paul SheldonKathy Bates as Annie WilkesRichard Farnsworth as Sheriff Buster, etc.

Hence, in this case, it is concluded that the psychological horror film based on a novel by Stephen King is known as Misery.

Learn more here: https://brainly.com/question/24949384

what process did the philadelphia convention device for ratifying the constitution and why

Answers

Answer:

What process did the Philadelphia Convention devise for ratifying the Constitution and Why? They used the ratification process that would go directly to the votes and get them to approve the Constitution. ... Anti-Federalist believed that the Constitution would create a government that people could not control.

Explanation:

Which of the following was one reason why the Georgia colony was established?
a. to provide religious freedom
b. to block the Spanish and the French
c. to prevent slavery from spreading
d.to help slavery gain a foothold

Answers

The answer is B. “To block the Spanish and the French” :)

2. Which of the following are States not allowed to do?

1. operate hospitals
2.make their own money
3. petition the Supreme Court
4. move or expand city limits ​

Answers

Answer:

2. Make their own money

Explanation:

States are not entitled to make their own money, as stated in the constitution. The framers did this to prevent from each state having its own currency, which would cause a lot of problems between states when people are traveling.

Hope this Helps! Please Mark Brainliest!

What is a common criticism of earmark spending?

Answers

Answer:

There are a couple reasons

Explanation:

They waste taxpayer funds, grow out of control, and encourage corruption, just to name a few.

How did the constitution guard against tyranny

Answers

Answer:

The three main ways that the Constitution protects against tyranny are Federalism, Separation of Powers, Checks and Balances. The Checks and Balances is included in the Constitution to protect the United States from tyranny.

Explanation:

hope it helps

mark me brainliest pls

HELP!!!!! ASAP!!!! Which factor prompted the passage of this legislation?
A. Denial of Labor union membership for unskilled workers
B. Increased nativism and anti-immigrant attitudes
C. Wage increases for workers in manufacturing positions
D. Increased U.S. Involvement in foreign wars and conflicts.

Answers

Answer: A

Explanation:

Answer:

thanks... it's A) Denial of Labor union membership for unskilled workers.

Explanation:

thanks... I hope you have a great FALL break!

what modern states territory was divided between the british and the french before the start of the french and indian war

Answers

Answer:

The border between French and British possessions was not well defined, and one disputed territory was the upper Ohio River valley.

Explanation:

pleaseee answer those 2 questionss

Answers

Answer:

what two questions you didnt put any up

Explanation:

how did the viking invasion affect the monasteries

Answers

Explanation:

the monks and nuns would fine artists and bring them to the monasteries to use their talents.

how many countries have hosted the olympics since 1896

Answers

Answer:

19

Explanation:

23 cities from 19 countries have hosted the summer olympics.

Hope this helps any!

Answer:

A total of 23 cities from 19 different countries has hosted the Olympics since 1896.

-Hope this helps (:

To prevent
, William Penn used the concept of
in the Frame of Government, a concept later used in the US Constitution.

Answers

Answer: absolutism and balancing the power

Explanation: This what I seen when I read the passage.

In the early years of World War I (1914-1917), the United States could correctly be described as
ОА.
a nation with an insignificant Immigrant population and an inactive military
OB.
Ос.
a populous and economically powerful nation practicing neutrality
a nation that had several powerful military alliances, following the military actions of allies
a militaristic nation with a large standing army involved in world affairs
OD
Undele
Next

Answers

United state can be described as populous and economically powerful nation practicing neutrality policy in the early years of World War I.

During the eruption of World War I in Europe, the Former US President Woodrow Wilson, proclaims the neutrality of the United States which prohibits the country from supporting or helping either country in the conflict, war, disagreement etc

During the period, the US had an above-average economy and a powerful military which protect its boundaries.

Therefore, the Option B is correct because the Nation had a great population and is economically powerful.

Learn more about Neutrality here

brainly.com/question/2412497

Answer:

B.   A populous and economically powerful nation practicing neutrality.

Over time, Pangaea started breaking apart, and the continents started __________ to where they are now.

a
disappearing
b
moving

Answers

The answer would be moving because they are in a different spot.
A. disappearing

Explanation because Pangaea started breaking apart

Analyze: In what ways do you think by John Locke's ideas influenced the kind of government that we
have today?

Answers

Answer:

casa. Completa las oraciones con el pronombre de objeto directo correcto, según el contexto.

1. Tu ropa está sucia. ¿Por qué no ____ lavas?

2. Ellos tienen muchos libros. ____ tienen en la estantería del despacho.

3. La casa de mi mamá tiene muchas ventanas, pero no ______ abre todos los días.

4. Profesora, Ud. debe usar la cochera. ¿ ______ve allí?

5. ¿Quieres ir al cine con nosotros? _____ llamamos antes de salir.

Explanation:

gotyitulkg

Which sentence correctly uses the term "New World'?


Vasco de Gama introduced a "New World" to the people of India when he brought European culture there.


Fifteenth and Sixteenth century Europeans saw the Americas as the "New World."


Christopher Columbus used "New World" to describe his goal of reaching the Indies and opening trade routes there.


The knowledge gained from the European voyages of exploration created a "New World" of information.

Answers

Fifth-teen and sixteenth century Europeans saw Americas as the new world

Answer:

Fifteenth and Sixteenth century Europeans saw the Americas as the "New World."

Explanation: Around the 15th and 16th century Columbus found the new world

how did the british government react to the boston tea party?

Answers

Answer:

The British responded to the Boston Tea Party by shutting down Boston Harbor. Shortly after that, Parliament passed several intolerable acts.

Answer:

The British response to the Boston Tea Party was to impose even more stringent policies on the Massachusetts colony. The Coercive Acts levied fines for the destroyed tea, sent British troops to Boston, and rewrote the colonial charter of Massachusetts, giving broadly expanded powers to the royally appointed governor.The Boston Tea Party caused considerable property damage and infuriated the British government. Parliament responded with the Coercive Acts of 1774, which colonists came to call the Intolerable Acts

Why does Massachusettensis mention the purchase of New York from the Dutch and the recent war with Canada? *

Answers

Massachsettensis mentioned those events to reinforce the author's arguments against the rebellion of the colonists.

Massachusettensis was the name used by lawyer Daniel Leonard to publish his letters of loyalty to Great Britain in the Massachusetts Gazette between 1774 and 1775.

In these letters, Leonard mentions the purchase of New York and the War with Canada to emphasize the will of Great Britain to make the empire bigger by favoring her territory in America.

In these letters, he calls on the colonists not to rebel against the British Crown, arguing that he has endeavored to maintain his territory in America in a remarkable way.

Learn more in: https://brainly.com/question/14198580

Members of the boule...

А

had too much power,

B

were required to be wealthy

с

contributed to important laws.

D

had to be elected by other citizens.

Answers

Answer: C. contributed to important laws.

Explanation: The boule was a group of 500 men, 50 from each of ten Athenian tribes, who served on the Council for one year. Unlike the ekklesia, the boule met every day and did most of the hands-on work of governance. It supervised government workers and was in charge of things like navy ships (triremes) and army horses.

Hope this helps you! :)

american diplomats and the american people were outraged with the french because of the ____

Answers

Answer: I do believe this is your answer: The French government's demand for a bribe to begin peace negotiations

Explanation: I hope this helps:)!

Which of the following is an example of the "message power"?

Answers

Answer:

The President outlining for Congress the specific items and amounts contained in the budget.

Drag each label to the correct location.
Determine whether the following characteristics describe conditions in Germany before or after unification.
written constitution
300 German states
trade facilitated
in the region
risk of French aggression

Answers

C I took the test I took the test hahaha

John Wilkes Booth was a Southern
Sympathizer.
What does that mean?
A. He wished he lived in the South.
B. He sided with the South in the Civil War despite living in
the North.
C. He was happy the North defeated the South in the Civil
War.
D. He felt the Civil War was a timeless fight.

Answers

Answer:

B He sided with the south but lived in the north

Why did the Middle Colonies and the Chesapeake region need large numbers of workers?

Answers

The Chesapeake colonies of Virginia and Maryland served a vital purpose in the developing seventeenth-century English empire by providing tobacco, a cash crop.

How do you feel about Hawai'i being one of the United States of America today? Is this a good outcome?

Answers

ANSWER: I feel great about Hawaii being one of the states in America, and it is a very food It shows that you don’t have to be on the US mainland in order to be a state.

what year did starbucks serve its first caffè latte sold

Answers

Answer:

1987

Explanation:

In 1984, Schultz convinced the Starbucks founders to test a coffeehouse feel in a new store they were opening in downtown Seattle. Here, the first Starbucks café latte was served. :)

Starbucks serve its first caffè latte sold in the year 1985.

What is Starbucks?

Starbucks is the brand in the segment of coffee beverages based In America. It offers varieties in the coffee by providing the facility of Customisation. The outlets or franchisee of this coffee brand is spread over various countries with 32, 000 outlets.

The objective of Starbucks was to provide the best Quality coffee at a reasonable price to their customers and make them taste the best. They are established in the year 1971 and served their first caffè latte sold in the year 1985.

They follow amazing marketing strategies to attract their customers and engage them effectively. They allow customization in the coffee based on the taste and preferences of the customers.

They also send greetings cards to members on their birthdays who were considered reward members and sometimes free drink vouchers to make them delighted with the services that Starbucks care for them.

Learn more about customer delight, here:

https://brainly.com/question/14301191

#SPJ6

immigrants from which country came to the untied states to build the railroads
A. Ireland
B. China
C. Guinea
D. Russia

Answers

Answer:

its complicated because immigrants from both Ireland and China came to US to build the railroads

Explanation:

A. Ireland

B. China

China made up most of the work force train tracks between Sacramento, California and promontory Utah

2. Most early religions were?
a. Polytheistic
b. Monotheistic
c. Democratic republics
d. Christian

Answers

Answer:

polytheistic

Explanation:

first religions worshiped multiple gods

Answer:

the answer is christian.

6 cities that were epicenters
help asap

Answers

Answer:

Tokyo, japan, jakarta, indonesia, manila, philipines.

plz mark brainliest

What is one way the Industrial Revolution brought negative results that still affect your life today?​

Answers

Answer:

The Industrial Revolution was the beginning of the large-scale urbanization seen today. It also created huge factories that create most of the everyday products used today. Both of these things have contributed to the pollution that affects the environment today. While factories do produce much of what we need they also create air pollution from the mass amounts of fossil fuels used. Additionally, urbanization has led to urban sprawl, which also contributes to pollution. It also increases the amount the average family spends on transportation.

Other Questions
Removing Shingles from a roof is called aO tear OffO Removing ShinglesO Shingle ReplacementO Remodeling roofing what do you think is the meaning of road rage? A fine fabric was selling for $10.50 per half yard. Joni bought 2 1/3 yards. How much did he spend? Brainliest for correct answer. Need help plz i will give brainlyist no scammer i will report and i only have 5 min Find four arithmetic means between -8 and 17. Which statement is NOT a reason Rosa Parks was considered the right person to be the face of the Civil Rights Movement? a Rosa Parks was married and had a good job. b Rosa Parks bridged classes and was comfortable and accepted in many different social settings. c Rosa Parks had lived in Pine Level, so she was familiar with Claudette Colvins family. d Rosa Parks was an adult who was widely known in the community. e Rosa Parks was well-liked and known as level-headed in the community. Need help on his ASAP El____(ir) a la bibloteca giving brainliest *easy* Please help, test due in 2 hours! Will give good review and brainliest. Here are summary statistics for randomly selected weights of newborn girls: n=250, x_=32.9 hg, s=6.9 hg. Construct a confidence interval estimate of the mean. Use a 95% confidence level. Are these results very different from the confidence interval 31.9 hg < < 34.5 hg with only 19 sample values, x_ = 33.2hg, and s = 2.9 hg? what is the complementary DNA of TACCGGATGCCAGATCAAATC? notes of Vibrational Motion or what they are what is y=-x-4 if x=-2 Help meh plssssssss!!!!!!!! Where does Ivan Jakovlevitch findMajor Kovaloff's nose? Name and describe three types of internal medicine specialties. The base of a triangular pyramid has an area of 20 square feet. The height of the pyramid is 36 feet. The volume of the pyramid is 720 cubic feet Need answer quick please Determine if the data is biased or not biased: A shirt manufacturer wants to check quality control of their products. The plant manager decides to check every 5th shirt inspected by Inspector D. There are 15 inspectors in the plant. BiasedNot Biased Steam Workshop Downloader