What Heterotroph mean?

Answers

Answer 1

Answer:

below

Explanation:

An organism whose food needs are met by complex organic substances.

Answer 2

Answer:

an organism deriving its nutritional requirements from complex organic substances.


Related Questions

b) How do you know the students in the above study are acting as scientists? (1 point)

Answers

Answer:

Could you edit the question and add the study, please?

Explanation:

Which is NOT a homeostatic mechanism?
O fecal regulation
O water regulation
oxygen regulation
thermoregulation

Answers

Explanation:

To be precise, homeostasis is a process/phenomenon not a system. Homeostasis is actually the process of maintaining a stable internal environment despite changes in the external environment. There are mechanisms in organisms that regulate pH and this regulation is an example of homeostasis.

the person credited with the axiom, "every cell from a cell" is __________.

Answers

I’m not sure but I think it’s Rudolf Virchow

Pls help pictures provided

Answers

Answer:

D. Matter is constantly cycling thought the environment

Explanation:

if im wrong im soo sorry

i hope it helps

an animal, that has gained new genetic information from the acquisition of foreign dna, is called a

Answers

Answer: Chimera

Explanation:

A genetic chimerism or chimera is a single organism composed of cells with more than one distinct genotype

Your DNA determines the color of your eyes and hair: true or false?

Answers

Your dna determines the color of your eyes and hair the answer is True

what 4 substances are recycled during photosynthesis and respiration?

Answers

Answer:

Carbon dioxide, Water, Oxygen and Glucose.

Mecayla harvests oysters from the shallow waters of the marsh near her home. She eats the shellfish almost every day. Her brother Kendis dislikes oysters but eats local predator fish from the river three times a week. Recent water quality tests show moderate levels of heavy metals in the river and marsh. What is the most likely result of this pollutant on Mecayla and Kendis if they maintain the same diet?
Mecayla will get sick first because she eats oysters every day.
Kendis will get sick first because of less bioaccumulation.
Biomagnification will cause Kendis to become ill first.
Bioaccumulation will cause Mecayla to become ill first.

Answers

Answer: Biomagnification will cause Kendis to become ill first.

Explanation: This answer is correct because Kendis is eating the predator fish and Mecayla is only eating some oysters from the shallow water. Biomagnification causes the concentration of toxins, specifically in the predator fish, therefore Kendis will become ill first.

Mecayla harvests oysters from the shallow waters of the marsh near her home. Biomagnification will cause Kendis to become ill first.

What is the ocean?

The existence of life on our planet is due to the oceans. Today, more than 230,000 marine species call the sea their home. Life began in the water.

Climate and temperature on Earth are governed by the oceans. They regulate temperatures and play a critical role in precipitation formation. The world's five oceans have a salinity that is around 3.5 percent on average.

The Mediterranean, the Atlantic, and the Bay of Bengal, on the other hand, have higher saline levels.

Therefore, Mecayla harvests oysters from the shallow waters of the marsh near her home. Biomagnification will cause Kendis to become ill first.

To learn more about the ocean, refer to the link:

https://brainly.com/question/16237714

#SPJ2

What is the correct order of the levels of organization in a living
thing, starting with the smallest level?

Answers

Well, if I’m not incorrect it should be, molecule, cell, tissue, organ, organ system, organism, population, community, ecosystem, biosphere.

What Is the biggest songbird in the world?

Answers

Hi there! I like songbirds, just as you might.

If I remember properly, the biggest songbird is the common raven! It's size can range from 22 to 27 inches long, while the tiniest is a hummingbird, ranging from 3.1 to 3.5 inches long.

Have a nice day!

The largest song bird is (Corvus Corax) also known as a Common Raven
Facts: Their lifespan is 10-15 years and can weigh up to 4.4lbs
They are around 22-27 inches long

A muscle cell has a solute concentration of 2% it is in a solution of 5% solute. What will happen
to the cell?

Answers

Answer:

But now you have two mixtures of different solute concentrations. In comparing two solutions of unequal solute concentration, the solution with the higher solute concentration is hypertonic, and the solution with the lower solute concentration is hypotonic

Explanation:

hope it helps :P

The cell will shrink as the solvent from low concentration solute will move towards the high concentration solute.

What is osmosis ?

Osmosis is the spontaneous net movement or diffusion of solvent molecules through a selectively permeable membrane from a region of high water potential to a region of low water potential, in the direction that tends to equalize the solute concentrations on the two sides.

Since the solute concentration in the muscle cell is just 2%, and the muscle cell is dipped in a solution that contains 5% solute, the solvent will flow from the muscle cell into the solution. This will result in the muscle cell becoming smaller until the concentration of solutes on both sides is equivalent.

Learn more about osmosis, here:

https://brainly.com/question/1799974

#SPJ2

4. The stars at the edges of a galaxy are rotating around the galaxy’s center at the same speed as the stars in the middle of the galaxy. How does this provide evidence of dark matter?
Dark matter absorbs light from outside the galaxy, allowing the light of the stars in the galaxy to show the orbital speeds of the stars.
Dark matter emits the light that astronomers need to see the orbital speeds of the stars.
Dark matter subtracts gravity, which allows the stars to rotate at the same speed.
Dark matter provides the gravity that allows the stars to rotate at the same speed.

Answers

Answer:

Dark matter provides the gravity that allows the stars to rotate at the same speed.

Explanation:

The stars at the edges of a galaxy are rotating around the galaxy’s center at the same speed as the stars in the middle of the galaxy. How does this provide evidence of dark matter?

Dark matter absorbs light from outside the galaxy, allowing the light of the stars in the galaxy to show the orbital speeds of the stars.

Dark matter emits the light that astronomers need to see the orbital speeds of the stars.

Dark matter subtracts gravity, which allows the stars to rotate at the same speed.

Dark matter provides the gravity that allows the stars to rotate at the same speed.

Please don't use these answers to cheat they are for help.

The statement shows that D. Dark matter provides the gravity that allows the stars to rotate at the same speed.

According to the information given in the question, it should be noted that the stars at the edges of a galaxy are rotating around the galaxy’s center at the same speed as the stars that are in the middle of the galaxy.

This implies that dark matter provides the gravity that allows the stars to rotate at the same speed. It should be noted that dark matter doesn't emit the light that astronomers need to see the orbital speeds of the stars.

Read related link on:

https://brainly.com/question/21222010

which cortex has six layers of the cells and pyramidal neuron as a principal cell?

Answers

Answer:

The cerebral cortex consists of neurons, nerve fibers and neuroglia. The cerebral cortex (neocortex) consists of six layers (in human the primitive arrangement into three layers persists only in the olfactory cortex and the cortical part of the limbic system in the temporal lobe).

Explanation:

Hope this helps...

Which of the following might make this ecosystem more sustainable?
A. if it supported more plant species, but fewer animal species

Answers

Answer:

Something that may make this sustainable is to remove food from there, or to add more animal species, particulary slightly invasive species that can eat the plants, and fast.

Oops didn't understand at first, yes this will make it more sustainable

Explanation:

To solve this we must be knowing each and every concept related to ecosystem. Therefore,  an environment with a large variety of plant and animal species is the correct option.

What is ecosystem?

An ecosystem is generated through the interaction of all life forms with each other as well as with the chemical and physical features of their surroundings, all of which are linked by the energy flow. It includes all of the living organisms in a given region in addition to their non - living things surroundings such as air, water, and sunshine.

Humans depend on ecosystems to meet their fundamental requirements. Ecosystems sustain us by providing safe drinking water as well as nutritious food. They supply raw materials for our clothes, housing, transportation, and energy needs.  An environment with a large variety of plant and animal species is more sustainable ecosystem.

Therefore,  an environment with a large variety of plant and animal species is the correct option.

To learn more about ecosystem, here:

https://brainly.com/question/22642458

#SPJ2

what three patterns of biodiversity did darwin observe

Answers

Answer:

Species vary globally, species vary locally, and species vary over time.

Explanation:

Darwin noticed three distinctive patterns of biological diversity.

Charles Darwin observed three patterns of biodiversity during his exploration on the voyage of the HMS Beagle and in his subsequent research:

Species Variation: Darwin noticed that within a particular species, there is a wide range of variation among individuals.

Geographical Distribution: Darwin observed that different regions of the world have distinct sets of plant and animal species.

Fossil Record: Darwin studied the fossil record and recognized that it contains evidence of extinct species that differ from those currently living.

Thus, these three patterns of biodiversity species variation, geographical distribution, and the fossil record were instrumental in shaping Darwin's theory of evolution by natural selection.

For more details regarding biodiversity, visit:

https://brainly.com/question/13073382

#SPJ6

What would be the strand of dna replicated from ATCGGATTTACCG

Answers

Answer:

The new DNA strand will have the bases GATCCA.

Explanation:

Adenine (A) always pairs up with thymine (T), and guanine (G) will always pair up with cytosine (C).

(Adenine and Thymine have only two places to form hydrogen bonds, whereas Guanine and Cytosine have three places. )

hope this helps in some way

What are 2 characteristics of the plasma membrane?

Answers

Answer:

they have flexibility and they help transport materials in and out of a cell

Question 25
1 pts
Which aspect of a chemical reaction is affected by enzymes?
0 rate
O direction
O equilibrium
Орн •

Answers

Answer:

Its rate

Explanation:

6. during the first part of prophase, dna condenses into?

Answers

Answer:

chromosomes

Explanation:

Fill in the Blank: Write the word that best completes each sentence..
17. Unlike animal cells, plant cells have
vacuoles, and a
wall.
cells have membrane-
18. Prokaryotic and Eukaryotic cells differ in that
bound organelles, and
cells do not have a nucleus.
19. Cell membranes are made up of a phospholipid bilayer. Which part of the phospholipid
bilayer interacts with water? Which part does not interact with water?
20. Name the three main parts of the modern cell theory.
1-
2-
3-

Answers

Answer:

Explanation:

1. Unlike animal cells, plant cells have vacuoles, and a cell wall

2. Cell membranes are made up of a phospholipid bilayer. Which part of the phospholipid bilayer interacts with water? Which part does not interact with water?    nonpolar fatty acid tails.                                                                                

3. first, that DNA is passed between some cells during cell division; second, that the cells of all organisms within a similar species are mostly the same, both structurally and chemically; and finally, that energy flow occurs within

how do frog eat there food

Answers

Answer:

Frogs use their eyeballs to swallow. Frogs eat their prey whole and their eyeballs actually sink down into their mouth and push the food down into their throat.

Which mineral has the biggest role on the growth of a plant…. Nitrogen or magnesium?

Answers

I think it’s nitrogen

please help its due today 50pts
appreciate it
You may choose either a plant cell or an animal cell. You must include the following parts of the cell:

Cell Wall (Plant only)
Cell Membrane
Cytoplasm
Nucleus
Endoplasmic Reticulum
Golgi
Ribosomes
Lysosomes
Vacuoles
Chloroplasts (Plant only)
Mitochondria


Cell City Map

Draw (or create a drawing using a program like PowerPoint) a city map and label locations that are analogous to the parts of the cell.

Your map should:

Include illustrations of each location.
A legend that identifies each location and explains how it relates to each part of the cell.
Be colorful, clear, and carefully drawn.
(Solo or Group)



Cell Story

Write a story in which the setting or the characters are analogous to parts of the cell. Throughout your story, you will include footnotes linking your setting elements or characters to parts of the cell. Your explanations must highlight a key characteristic of each part of the cell.

Your story should:

Include representations of each part of the cell.
Include footnotes explaining the links between your representations to the parts of the cells
Be written with proper grammar, spelling, and formatting.

Answers

Answer: cytoplasm: a thick solution that fills each cell and is enclosed by the cell membrane.

Nucleus:the central and most important part of an object, movement, or group, forming the basis for its activity and growth.

Explanation:

wa i afunwhich meal would provide he most energy as well as as the material needed to build muscle

Answers

Answer:

Whichever meal is the highest in protein.

Explanation:

Protein keeps you feeling fuller for longer, gives you long term energy and it also helps build muscle.

PLEASE HELP WILL MARK BRAINLIEST !!

Which of the following is used to determine the relative ages of the rock?

Cross-cutting relationships

Superposition

Fossils

All of the above

Answers

Answer:

fossils because they have been on earth more then 20 million yrs

Fossils Bc they been around for a long time

at the end of glycolysis the carbons of glucose are converted to

Answers

Glycolysis. In glycolysis, glucose—a six-carbon sugar—undergoes a series of chemical transformations. In the end, it gets converted into two molecules of pyruvate, a three-carbon organic molecule.

What is a concentration of mineral fragments at the bottom of a streambed called? Choose the correct answer.
O nodule
O placer deposit
O native element
O hydrothermal solution

Answers

Answer:

B. Placer deposit

Explanation:

Quizlet called "7-1 Science Mineral Resources" with answers

Una botella de vidrio tiene propiedad de dureza ?

Answers

Answer:

si

Explanation:

Se trata de un material inorgánico y duro entonces tiene propiedad de dureza porq no es elastico

Part E
State two questions you still have about GMO foods.

Answers

Answer:

Do GMOs Cause Cancer?Have Long-Term Health Studies Been Conducted on GMO Crops?

Explanation:

D. How is the energy produced by respiration stored?

Answers

Answer:

the nucleoside triphosphate ATP

Answer:

Respiration releases energy - it is an exothermic process. The energy is stored in molecules of ATP . ATP can be broken down in other processes in cells to release the stored energy.

Explanation:

pls give me brainliest pls

Other Questions
I lift a 20kg ball up 2.5 meters off the ground on Earth.-Earths gravitational acceleration is about 9.8 m/s2.How much gravitational potential energy does the ball have at this point? _____________How much work did I do lifting up the ball? _____________________________________If I lift the same ball the same distance on the Moon, then how much gravitational potential energy will it have? (Moons Gravity = 1.6 m/s2) ____________________________________ Which signposts uses words that have a strong connotation?-Contrast and contradictions-Extreme or absolute language -Numbers and stats Based on the maps, what region did more railroads tracks develop - the North or South? Why do you think so? Of the 180 students in Mrs. Stanfield's class,60% are girls On Thursday, 25% of the girls in theclasses dressed up for Wacky Tacky Day. How manygirls dressed up? Should English be capitalized in this sentence?Today I went to English class. A battery causes a current of 2.0 A to flow through a lamp. The power used by the lamp is 12 watts. What is the voltage? Which of the following is an example of intrinsic motivation?A.composing a piano tude for extra credit in your music appreciation course B.writing a song to perform at your parents' 25th anniversary party C.creating a mixed-media collage in hopes of winning a blue ribbon at a local art fair D.building a robot to enter in a competition that offers a $500 first prize Which option describes a research question? (1 point)O a question that identifies a topic that you want to learn more aboutO a question that reveals where you can find information about a topicO a question placed in the conclusion of an essay to me the reader thinka question that encourages the reader to find out more about the topicNo Which of the following characteristics of the planet, Earth, is essential tothe survival of every living organism?*Earth has abundant available water.O Earth has just one orbiting moon.O Earth orbits the Sun once every 365 days.O Earth rotates on its axis once every 24 hours. Two toy robots are turned on at the same time. The first robot beeps every 24 seconds. The second robot beeps every 36 seconds. In how many seconds will they beep at the same time? Choose only ONE best answer. 12 B 24 36 72 E 96 PLEASE HELP I ONLY HAVE AN HOUR LEFT !!!!!! please help me with this chem question!! Which phrases tell causes of suffering for blacks in northern cities after World War II? Choose all answers that are correct. Look at the net of square pyramid below l. What is the surface area? Solve by grouping 8x^3+3+6x^2+4x A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include "The blue whale is the world's largest animal. What other amazing feature isit known for?*A) Its the quietest animalB) Its the loudest animalC) Its the heaviest animalD) Its the lightest animalChoose one of them. to be useful for most household applications, DC voltage is?please Which of the following best describes Darwin's (and Wallace's) theory of evolution?Question 1 options:Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the islandThe diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection. Un coche inicia un viaje de 450 km a las ocho de la maana con una velocidad media de 90 km/h. A qu hora llegar a su destino? Steam Workshop Downloader