What is the value of y when x = 3 for the line defined by the equation y = -2x + 5?

Answers

Answer 1

Answer:

y=-1

Step-by-step explanation:

Plug in the value of x:   y=-2(3)+5

Multiply:   y=-6+5

Add:   y=-1


Related Questions

Evaluate.

(w2x−3)÷10⋅z when w=−4, x = 0.8, and z=−4/5

Enter your answer as a simplified mixed number in the box.

Answers

Answer:

⅘ ≈ 0,8

Step-by-step explanation:

(w2x - 3) ÷ 10 × z

= (-4 × 2 × 0,8) ÷ 10 × -⅘

= (-8 × 0,8) ÷ -8

= -6,4 ÷ -8

= ⅘ ≈ 0,8

Conclusion:

Evalute (w2x - 3) ÷ 10 × z is ⅘ ≈ 0,8.

[tex] [/tex]

After using the linear equations method we will get 1.76.


What is linear equations?
An equation is said to be linear if the highest power of a variable is consistently 1. Another name for it is a one-degree equation. A linear equation with one variable has the standard form Ax + B = 0. In this case, the variables x and A are variables, while B is a constant. A linear equation with two variables has the standard form Ax + By = C. Here, the variables x and y, the coefficients A and B, and the constant C are all present. A linear equation is one that has a degree of 1 as its highest value. No variable in a linear equation, then, has an exponent greater than 1. A linear equation's graph will always be a straight line.

How to calculate question by adding their values in the given equation?

firstly, the given equation is: [w2x-3]/10z
the things or values which are given to us:
w=-4x=0.8z=-4.5
Now putting all the values in the given equation:
[-4*2*0.8-3]/10*-4.5-9.72/-5.5
[by solving the brackets]1.76 [by solving the equation]

Hence the answer is, 1.76

To learn more about linear equations
https://brainly.com/question/2030026
#SPJ2

a car travels at an average speed of 64 miles per hour. How long does it take to travel in 3 hours and 30 minute

Answers

Answer:

4 hours and 30 minutes 288/64 = 4,5

Step-by-step explanation:

Evaluate the expression

Answers

12 - { 1+2 [ -1 (3-8) ]² }= 12 - { 3 [ -1 (-5) ]² }= 12 - { 3 [ 5 ]² }= 12 - { 3 (25) }= 12 - {75}= 63

please mark this answer as brainlist

3 2/3 +2.3with a line on top of the three =

Answers

Answer: =5 29/30

Step-by-step explanation:

Solution by separating parts

Rewriting our equation with parts separated

=3+2/3+2+3/10

Solving the whole number parts

3+2=5

Solving the fraction parts

2/3+3/10=?

Find the LCD of 2/3 and 3/10 and rewrite to solve with the equivalent fractions.

LCD = 30

20/30+9/30=29/30

Combining the whole and fraction parts

5 + 29/30=5 29/30 hope this helps

Answer:

Do you mean 3⅔ + ⅔? If so, the answer is 4⅓.

Step-by-step explanation:

3⅔ + ⅔

[convert mixed fraction to improper fraction]

11/3 + 2/3

[LCM is 3]

(11+2)/3 = 13/3

[convert improper fraction to mixed fraction]

13/3 = 4⅓

Solve the inequality
-5/2(3x-2)<6-2x.
Show and explain every step.

Answers

Answer:

its true the answer is true but would u need a whole Paragraph like an explanation I could make one for you.

The solution of the inequality ( - 5 / 2 ) ( 3x- 2 )< 6 - 2x. will be x < ( 18 / 11 ).

What is inequality?

inequality is the relationship between two expressions that are not equal, employing a sign such as ≠ “not equal to,” > “greater than,” or < “less than.”.

Given inequality will be solved as below:-

( - 5 / 2 ) ( 3x - 2 ) < 6 - 2x

Multiply the other hand by 2 and solve further.

( - 5  ) ( 3x - 2 ) < 2 ( 6 - 2x )

( - 5  ) ( 3x - 2 ) < ( 12 - 4x )

Take like terms to the same side and solve.

-15x + 30 < 12 - 4x

-15x + 4x < 12 - 30

-11x < - 18

x < 18 / 11

Therefore, the solution of the inequality ( - 5 / 2 ) ( 3x- 2 )< 6 - 2x. will be x < ( 18 / 11 ).

To know more about inequality follow

https://brainly.com/question/24372553

#SPJ2

PLZ HURRY IT'S URGENT!!!

What is the measure of < C?


options:


30°



60°



90°



180°

Answers

Answer: [tex]60^{\circ}[/tex]

Step-by-step explanation:

x + 2x + 3x = 180 [angles in a triangle add to 180 degrees]6x = 180 [combine like terms]x = 30 [divide both sides by 6]

So, [tex]\angle C=2(30)=\boxed{60^{\circ}}[/tex]

4325 as a product of its prime factors

Answers

Answer:

5*5*173=4325

Step-by-step explanation:

please mark brainiest hope it works out for you

Answer:

5²×173

Step-by-step explanation:

4325 as a product of its prime factors

5²×173

Can you help me with this please I don’t understand

Answers

Answer:

12

742

127.5

Step-by-step explanation:

If it's the area that 6*4=24, but it's not sqaure it's half ,so 24/2=12

742

127.5

pls help asap!!!!!!!!

Answers

Answer: 41

Step-by-step explanation:

The horizontal line beneath the angle created is always 180 degrees. Because you are given two equations for each angle created, simply write: 180= (3x-3) +(x+19). This gives you 4x+16=180, of which you subtract 16 to 180 which gives you 164. Finally, divide both sides by 4: 4x/4=164/4 and you will get 41. Hopefully I was of aid to you.

13.On many multiple-choice tests, 1 point is given for each correct
answer and 0.25 point is taken away for every wrong answer.
(This is to discourage guessing.) Answers that are left blank
do not affect the score. Gloria scored 62 on a test with 100
questions. Let C be the number of questions Gloria correctly
answered and let W be the number of wrong answers she had.
Give three possible pairs of values of C and W.
b. Write an equation that describes all possible solutions.
c. Graph all possible solutions.
a.

Answers

C is the answer I believe

Hoped it helped

Guided Practice


A line passes through the given points. Write an equation for the line in point-slope form. Then rewrite the equation in slope-intercept form.


(3, –8), (–2, 5)


A.
y+8= 13/5 ( x−3 ); y= 13/5 x− 1 5


B.
y−8=− 13/5 ( x+3 ); y=− 13/5 x+ 1 5


C.
y+8=− 13/5 ( x−3 ); y=− 13/5 x− 1 5

Answers

Answer:

Step-by-step explanation:

Write in slope-intercept form,  

y = m x + b .

y = − 13 /5 x − 1 /5

Somebody please help me w/ this <3

Answers

Answer:

2 times

Step-by-step explanation:

The longest worm is 2 times the length of the shortest worm

can somebody help me with social studies please ????
Somebody please answer
Will get brainlist if you help me

Answers

Sure, drop your question :)

Answer:

what do you mean? what's the question?

What is the range of the function graphed below?

Answers

I’m not 100% sure but I think it’s the first one

If the word is a proper noun, choose the answer that begins with a capital letter. If the word is a common noun, choose
the answer that begins with a small letter.


School
school

Answers

school is not a a proper noun so it will start with a lowercase letter

Can someone help me with Question 1 Please? I forgot how to do it- Also, No links please!​

Answers

Answer:

[tex]\frac{5}{6}[/tex]

Step-by-step explanation:

Hi there!

We are given the following expression:

[tex]\frac{1}{6}[/tex] ÷[tex]\frac{1}{5}[/tex]

And we would like to solve it

Whenever we are dividing fractions, we are actually multiplying the first fraction (in this case, 1/6) by the reciprocal of the second fraction (in this case, 1/5), which is the "flipped" version of that fraction; the value that is in the numerator becomes the value in the denominator, and the value in the denominator becomes the value in the numerator.

So the reciprocal of 1/5 is 5/1, or 5/1

So we will multiply 1/6 by 5

[tex]\frac{1}{6} * 5 = \frac{5}{6}[/tex]

The fraction is in the simplest form; 5/6 is the answer.

Hope this helps!

1/6 divided by 1/5
When dividing fractions we keep the first fraction the same , change the sign to multiplication and flip second fraction. Some teachers use KCF (keep change flip) as a way for students to remember .
So let’s do it :
1/6 x 5/1 = 5/6
Your answer is 5/6

Hellooooooo I need help with this !!!!!

Answers

Answer:

c. 270m^3

Step-by-step explanation:

To find the volume of a rectangular prism, multiply its 3 dimensions: length x width x height.

6×5×9

30×9

270

I DON'T KNOW HOW TO PROVE THIS IDENTITY, CAN U GUYS HELP ME ?​

Answers

Try this way, all the details are in the attachment.

what is the sum of the infinite geometric sequence 2,-1,1/2,1/4,...?
with solution

Answers

The common ratio with the range  

1<r< 1

the formula is  

S=a11−r

We will use this formula because,  

r=12

Sum  

S=a11−r=21−12=4

God bless....I hope the explanation is useful...

4x^2 times what equals -5x^2

Answers

Answer:

-1.25

Step-by-step explanation:

-5/4=

-1.25

check answer

4*-1.25= -5

Help Me !!!!!!!!!!!!

Answers

Marta has a better estimate

Step-by-step explanation:

cause let's round both one to the nearest ten. 260*30

then let's cancel both zeros to make it easier

26*3=78 and just add on two zeros at the end

clearly Marta estimate is better as it is closer to 7800

7 divided by $15.02. Round it by the nearest cent. QUICK!!

Answers

The answer would be 7/15.02= approximately 0.47

HELP LAST ATTEMPT !?!!

Answers

Answer:

x=26

Step-by-step explanation:

4x+1+2x+23=180 [Angles in a straight line]

6x=180-24

x=156/6

x=26

Mr. Singer's choir is going to New York City for a choir competition. He wants them to look their best, so he buys new music folders for all of the members. Each music folder costs $7.99. If Mr. Singer buys 23 music folders, how much does he spend?

Answers

Answer: 183.77

Step-by-step explanation:

23*7.99 =183.77

Javier reads 40 pages every hour, how many pages does Javier reads in 2.25 hours?

Answers

Answer:

Javier reads 90 pages in 2.25 hours.

Step-by-step explanation:

# of pages read every hour: 40 pages.

# of hours in total: 2.25 hours.

Multiply the number of pages he can reads every hour (40 pages) by the number of hours in total.

40 x 2.25 = ?

The Product is your answer;

? = 90

Hope this helps :)

Will mark brainliest for all 4 :)

Answers

Answer:

1=2 weekday  3 weekend

2=4 weekend 8 weekday

3=?

4=3 bleachers 4 lawn

Step-by-step explanation:

HELPPPPPPP
which relationship shows a quadratic variation?​

Answers

Answer:

The first option

Step-by-step explanation:

The first option:

f(x) = 4(x^2)

Each time x is squared and then multiplied by 4.

___

f(1) = 4(1^2) = 4

f(2) = 4(2^2) = 16

f(3) = 4(3^2) = 36

f(4) = 4(4^2) = 64

Answer:

The first one

Step-by-step explanation:

This is because the function of it is f(x) =  4x^2. Additionally, this can be seen as there is not a perfect difference between the values.

Hope this helps... Feel free to mark this as brainliest! :D

Suppose 96% of students chose to study Spanish their freshman year, and that meant that there were 504 such students. How many students chose not to take Spanish their freshman year?

Answers

Answer: pls mark brainliest

20.24 students

96 percent of 506 is 485.76

506 - 485.76 = 20.24

I need help anyway can help me

Answers

Answer:

With what?

Step-by-step explanation:

Just give me your question

What do you need help with??

Which equation represents a line that is perpen-
dicular to y = 5x +2 and goes through the point
(-10, 3)?

Answers

Answer:

A

Step-by-step explanation:

If you substitute the values given in the question, i.e. (-10,3), the only equation that satisfies this solution is A.

Try substituting

x for (-10)

y for (3)

Other Questions
Why is 250 million years called a cosmic year?Thats the amount of time it takes the Milky Way to revolve around the Universe core.Thats the amount of time it takes the Milky Way to rotate on its axis.Thats the amount of time it takes the solar system to rotate on its axis.Thats the amount of time it takes the solar system to revolve around the Milky way core. 3 situations that give friction a bad reputation Fill in the BlankValues..ArtifactsPrice of Goods.LanguageNormsAfrican TribeCommandTraditional Native Americans1 Socialism and Communism fit in which type of economy?2. What does supply and demand determines?3. What are the major elements of culture?4 What economy bases economic decisions on customs and beliefs?are real world examples Based on what you know about portable parts, which of the following words best completes the sentence below? The test ____, was in that it covered all the information from the whole year. O A. conjoin O B. persuasive O C. militant O D. comprehensive RIGHT ANSWERS ONLY. Below are four euphemisms for the phrase in bold in the following passage. Which one best matches the tone of the passage?So I followed Goofballs directions to the joint where I was to meet the big man. Big man is right! The guy was really fat, to say the least! Man, I bet the guy could eat the back end of a cow, then wash it down with a Himalaya sundae!a. chunkyb. big-bonedc. a super porkerd. quite portly need explanation with these problems! help me please! Sort the cultural values and beliefs about women into the appropriate categories. Decide whether each was commonbefore or after changes in the late 1800s. Pls help. I will give you 10 points! Can somebody help me asap pls help me i will give 30 points help me pls don't type random letter or I will report u ty 1. Vamos a hacer un picnic en el parque hoy.A. lllgicoB. Lgico2. El primer da del ao es un da festivo, pero ese da casi todo el mundo est cansado! A. lllgicoB. Lgico3. La familia de Migdalia es enorme. Tiene parientes en casi todo el Mxico.A. lllgicoB. Lgico4. El beb de Sofa cumpli ayer 29 aos. Es muy simptico! A. lllgicoB. Lgico5. Muchos bebs tienen la costumbre de llorar cuando tienen hambre.A. lllgicoB. Lgico6. Qu desastre! Ayer fue el cumpleaos de Julio Andrs y se me olvid felicitarlo!A. lllgicoB. Lgico7. Una persona educada es una persona que no tiene buenos modales. A. lllgicoB. Lgico8. La fiesta de sorpresa para la Srta. Gutirrez fue excelente. Ella nos ayud a prepararla!A. lllgicoB. Lgico9. La abuelita de mi amiga Idalia naci hace dos das.A. lllgicoB. Lgico10. Alrededor del museo haba estatuas antiguas y modernasA. lllgicoB. LgicoHelp please Suzie looked at the diagram at right and wrote 134%=134/200. Is she correct? It is important to consider the social, emotional, physical, and economic effects of teen pregnancy on the teen parent, the child, the family, and society. Think about your goals for the future and how they could be affected by teen pregnancy. Use this decision-making process document to help brainstorm your ideas and organize your thoughts. Then respond to the prompt. the half-life of roentgenium -281 is 17 seconds,if 10 grams are left after 85 seconds,how many grams were initially in the original sample? Find the midpoint of the line segment with endpoints (-3, 2) and (1.-2)A)(-1,0)B)(0, -1)(-2,0)D)(0, -2) The radius of a circle is 11 millimeters. What is the circle's circumference? Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG The Know-Nothing Party opposed which of the following? 1) What is your Dawn Wall and how are you approaching it? What is the expected outcome? (Or, reflect on a 'Dawn Wall' in your past and discuss how you overcame it.)2) Describe a few things that Kevin and Tommy had to overcome to realize their goal. (Or, describe what things had to be in order or exist for their goal to be realized.) Steam Workshop Downloader