Who created this piece of art?
A. David hammons
B. Christo and Jeanne-Claude
C. Robert smithson

Who Created This Piece Of Art?A. David Hammons B. Christo And Jeanne-Claude C. Robert Smithson

Answers

Answer 1

Answer:

B

Explanation:

Christo and jeanne-claude made that art piece.


Related Questions

Who painted the image above?

Answers

Answer:

Explanation:

Painting by Pablo Picasso

Please solve this equation. Thank you.

Answers

variables:
pikatchu = p
pikatchu = k

p + k = baby

very complicated i will get back to you on this

If an artist brought their sketchbook to a symphony and made quick sketches of the musicians, this would be a good example of utilizing drawing as a way to__________________.

Answers

Answer:

Exprese music and art

Explanation:

please mark brainliest

Answer:

express music and art

Explanation:

What is the quality of the seventh chord in every Major key?
A.Diminished
B.Major
C.Minor
D.Augmented

Answers

Answer:

major maybe? I'm not really sure, sorry if it's wrong

If a multimeasure rest has a two on top, what do you do?

Answers

Answer:

i think i suggest

Explanation:

Minim Rest

i hope this will help you

When creating Star Wars, its creator, George Lucas, used ________________ to create many of the battle scenes. a. go motion and compositing c. compositing b. puppetry d. go motion and motion capture

Answers

Answer: A. go motion and compositing

Explanation:

Edgeu answer

Answer:

a

Explanation:

Choose a music career from the list given below that you would be interested in pursuing, and provide appropriate reasoning for your choice of profession. You can perform online research regarding these fields to compare and contrast the possibilities available to you, and then write your answer accordingly.

music composer
music arranger
private instructor
session musician
theater musician
primary school music teacher
performing artist
booking agent
manager (for artists, music groups, or bands)

Answers

Answer:

Explanation:

Choose a music career from the list given. I would choose primary school music teacher. I would choose this because I like to work with kids. A pro about working with kids and this job is you get express you inner kid and your love for music. Yes the other jobs listed you still get to exprees you love for music put as studies showed people who work with kids are more happy and more productive. This cuncludes on why I pick primary school teacher.

931-625-5884
Is this a U.S. number?
true.
false.

Answers

Answer:

False

Explanation:

Because the U.S number is ten digits. The first three digits are the area code, which,in the past ,indicated in what part of the country the phone was located

Why doesn't Temple want to go to college?

Answers

Because college suckssssw

Answer: chil e id k

Explanation:

Philosophical thought tended toward
at this time.

-expressionism
-humanism
-rationalism
-humanitarianism

Answers

Answer:

I belive the answer is humanitarianism.

Explanation:

Because humanitarianism focuses on the value of human life other than worshiping gods or the supernatural things.

Which statement describes a characteristic of Early Renaissance art?


Figures have unnatural proportion to evoke an emotional response.


It focuses on religious subjects because the church was the only patron.


It depicts the beauty of the human form and nuances of human expression.


Sculpture is connected to an architectural framework for added support.

Answers

Answer:

It focuses on religious subjects because the church was the only patron. It depicts the beauty of the human form and nuances of human expression.

Explanation:

Answer:

It depicts the beauty of the human form and nuances of human expression.

Please solve this mathematical equation π↓⊆∵⊆∫⊆∞∪≅↓⊃∅±

Answers

Answer: that pikachu looks like it is having a good time

Explanation:

Answer: The answer is your mom.

Explanation: What is life bro, also them pikachus be goin AT IT

4. What were the earlier sources of the songs Charlie Patton, the Mississippi Sheiks, and others performed in and around Dockery Farms?

Answers

Answer:

Explanation:

Dockery Farms began as a cotton plantation in the Mississippi Delta. ... unforgettable Delta bluesmen as Charley Patton, Robert Johnson, Son ... recorded using the name the "Mississippi Sheiks" at their musical jobs throughout the area

Which of the following is defined as a biscuit or cracker made from flour, water, and salt used for armies before the invention of canning?

bread
hardtack
rusk
crust

Answers

Answer:

hardstack/cracker

Explanation:

i did some research

Aug 28, 2019 — He invented "Granula" in 1863 - fifteen years before Kellogg. ... Hardtack (sometimes called a "cracker" or "ship's biscuit") was a common sight on ... Made of just flour, water, and salt, hardtack was, well, hard. ... Some rusks, like zwieback, were even yeast-leavened sweet breads that were twice baked.

this is from one of the articles I found, not my work

Hey guys i am begging you i really need help!!!!!!!
pleaseeeeeeeeeeeeeee

please can you write a background story for a 90s character that would be on the back of those toys in the boxes the character is Tzar Nicholas 2!!!!!!!!!!!!!!!!!!


I am begging you!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

here it is

Explanation:

Nikolai Aleksandrovich Romanov was born near St Petersburg on 18 May 1868, the eldest son of Tsar Alexander III. When he succeeded his father in 1894, he had very little experience of government. In the same year, Nicholas married Princess Alexandra of Hesse-Darmstadt (a duchy in Germany). They had four daughters and a son, Alexis, who suffered from the disease haemophilia.

Alexandra was the dominant personality in their relationship and encouraged the weaker Nicholas's autocratic tendencies. He mistrusted most of his ministers and yet was incapable of carrying out the task of ruling the vast Russian empire alone.

Determined that Russia should not be left out in the scramble for colonial possessions, Nicholas encouraged Russian expansion in Manchuria. This provoked war with Japan in 1904. The resulting Russian defeat led to strikes and riots. In January 1905, on 'Bloody Sunday', the army in St Petersburg shot at a crowd demanding radical reforms. Opposition to the tsar grew and Nicholas was forced to grant a constitution and establish a parliament, the Duma.

Nicholas's concessions were only limited. Changes were made in the voting laws to prevent the election of radicals and the secret police continued to crush opposition. However, the Duma did give many more people, especially the middle classes, a voice in government.

The outbreak of World War One in 1914 temporarily strengthened the monarchy, with Russia allied to France and Britain against Austria-Hungary and Germany. In mid-1915 Nicholas made the disastrous decision to take direct command of the Russian armies. From then on, every military failure was directly associated with him.

With Nicholas often away, Alexandra took a more active role in government. Russia was suffering heavy losses in the war, there was high inflation and severe food shortages at home, which compounded the grinding poverty most Russians already endured. German-born Alexandra soon became the focus of discontent, as did her confidante, the mystic, Rasputin, who had been at court since 1905 and had gained great influence through his apparent ability to treat the haemophilia of Alexis, the heir to the throne.

In December 1916, Rasputin was murdered by a group of disaffected nobles. Then in February 1917, widespread popular demonstrations began in the capital Petrograd (as St Petersburg was renamed in 1914). Nicholas lost the support of the army and had no alternative but to abdicate. A shaky provisional government was established. The tsar and his family were held in various locations, eventually being imprisoned in Yekaterinburg in the Ural Mountains.

In October 1917, the Bolsheviks overthrew the provisional government. Following a harsh peace treaty with Germany in March 1918, Russia descended into civil war. On 17 July 1918, as anti-Bolsheviks approached Yekaterinburg, Nicholas and his family were executed. This was almost certainly on the orders of the Bolshevik leader Vladimir Lenin.

Who to uses the dynamics in classical music ?

Answers

Not sure if you worded this question correctly but....

Dynamics are ways that help you convey the music more musically
P= piano
Pp= pianissimo
F=forte
ff= fortissimo
M= mezzoforte

How did American Abstract Expressionist painter Jackson Pollock apply paint to canvas?

Answers

Pollock famously placed his canvas on the ground and danced around it pouring paint from the can or trailing it from the brush or a stick. !

Answer:

Pollock used sticks and brushes to drip and splatter paint on canvas that was on the floor.

Explanation:

What are the principles of design as applied in theatre? How do these help make a splendid production?

Answers

Answer:

The principles of design are harmony, variety, balance, proportion, emphasis, and rhythm. Harmony creates the impression of unity. Typically directors and designers seek to harmonize the parts of each setting or costume and to relate the various settings and costumes in such a way that all are clearly parts of a whole.

Explanation:

Who eventually stood up to the Duke against his wrong doings on Bach's behalf in Bach's Fight for freedom?

Answers

Answer:

Potato

Explanation:

Question 9 of 10
Look at this photograph of a Ming vase. It is made out of kaolin clay, a
material first used during the Ming dynasty. What is special about kaolin clay?
MM
A. It makes blue pottery, the white is added to the design as a glaze.
B. It turns black during firing, much like the black-figure technique of
ancient Greece
C. It was abundant near the Yangtze river in China and therefore
inexpensive
D. It can withstand very high firing temperatures and is stronger as a
result

Answers

D it fires white and is made for making white China it also was used to help absorb grease from skin

Answer:

D

Explanation:

Which is the better band

Twenty One Pilots

Panic At The Disco

Fall Out Boy

Queen

The White Stripes

Greta Van Fleet

The Score

The Beatles​

Answers

Answer:

the Beatles because they make good music and I do not know

Answer:

The Beatles and Queen

Explanation:

Both are great bands


10 steps of orographic rain fall​

Answers

Answer:

Orographic precipitation, rain, snow, or other precipitation produced when moist air is lifted as it moves over a mountain range. As the air rises and cools, orographic clouds form and serve as the source of the precipitation, most of which falls upwind of the mountain ridge.

Explanation:

The Cappella Giulia waša training school for choir members who sang at this famous
location in Rome.

Answers

The answer is Giovanni pierlugi

Antonio Vivaldi, an Italian composer
of the Baroque period,

A. only completed two compositions.
B. became extremely wealthy and famous during his
lifetime.
C. spent much of his career teaching music at an
orphanage.

Answers

The correct answer is C. Spent much of his career teaching music at an orphanage.

Explanation

Antonio Lucio Vivaldi (1678-1741) was an Italian composer, violinist, and teacher of the Baroque era, being one of the most popular throughout Europe and one of the main influences of the also classical music composer Johann Sebastian Bach.

At the age of 25, he entered to work as a violin teacher in an orphanage called Ospedale Della Pietà and lasted there for the next thirty years. During this time Vivaldi composed most of his most important works. So the correct answer is C. Spent much of his career teaching music at an orphanage.

Who wants to build me a house on bloxburg my user is: Stranger_Things1110

Answers

Answer:No

Explanation:You like stranger things

Yeah sure message me when u want me to

Which of the following techniques is used in the image?

Pull-off
Hammer-on
Root strum
Slide

ANSWER ALLLLLL PLZ

Answers

Answer:

5. Slide

7. Africa and Europe

I am not sure this one is Power Chords

9. New Orleans

Explanation:

Answer:

5. This is a hammer-on (slides are notated with a diagonal line between the numbers in TAB format)

6. Africa and Europe

7? ( I don't know what number this question is) The chords all share the same quality.

8. New Orleans is known as the birthplace of jazz

Explanation:

Is this good enough to submitt as my portfolio in art?

Answers

Answer:

nice ❤️ nice you are a professional

Answer:

yes!

Explanation:

It looks like you put in a lot of work to create it!

Which of the following choices is an example of Passive Listening?
Oo oo
doing homework with the TV playing in the background
listening to the radio while cleaning your room
hearing street noises as your walk to school
All of these choices are correct.

Answers

Answer:

All of these choices are correct

Explanation:

Passive listening is basically background noise that you hear but you are not paying a lot of attention to it. It kind like multitasking just giving one thing more attention.

2
Select the correct answer.
Who wrote and recorded This Land is Your Land?
O A
Bob Dylan
OB.
Pete Seeger
C.
Woody Guthrie
OD. John Denver



Answer: C, Woody Guthrie

Answers

Answer:

c

Explanation:

Woody Guthrie recorded This Land is Your Land

Woody Guthrie wrote and recorded This Land is Your Land. Option (c) is correct.

What do you mean by Land?

The term "land" refers to all natural components that have been given to a particular area or piece of property.

Guthrie's song "This Land Is Your Land," which he penned while residing in New York City, was a reflection of both his love for his nation and his commitment to supporting the common man.

Guthrie made the decision to combat music with song in February 1940. He wrote a straightforward song in response to "God Bless America" that attempted to express his admiration for the American scenery. He also wanted to make it clear that many Americans didn't feel at all blessed.

Therefore, Option (c) is correct. Woody Guthrie wrote and recorded This Land is Your Land.

Learn more about Land, here;

https://brainly.com/question/27588497

#SPJ2

help!!!! please i give brainly-est :>

Answers

Answer this would kinda help you

a sentence having two or more coordinate independent clauses and one or more dependent clauses.

Answer:

The sentence with Sharon

Explanation:

The second sentence we have the subordinating conjunction "even though" We never start a sentence with because so it's not the first one, despite having the conjunction.

Subordinating conjunctions to look for

"Until"

"Even though"

"If"

"When"

"because"

As the other person answered you do need a dependent and independent clause:

Example: Let me know if you need help.

Let me know is the independent clause. Another good hint is that the dependent clause usually starts with the conjunctions mentioned

Other Questions
Can somebody help me asap pls help me i will give 30 points help me pls don't type random letter or I will report u ty 1. Vamos a hacer un picnic en el parque hoy.A. lllgicoB. Lgico2. El primer da del ao es un da festivo, pero ese da casi todo el mundo est cansado! A. lllgicoB. Lgico3. La familia de Migdalia es enorme. Tiene parientes en casi todo el Mxico.A. lllgicoB. Lgico4. El beb de Sofa cumpli ayer 29 aos. Es muy simptico! A. lllgicoB. Lgico5. Muchos bebs tienen la costumbre de llorar cuando tienen hambre.A. lllgicoB. Lgico6. Qu desastre! Ayer fue el cumpleaos de Julio Andrs y se me olvid felicitarlo!A. lllgicoB. Lgico7. Una persona educada es una persona que no tiene buenos modales. A. lllgicoB. Lgico8. La fiesta de sorpresa para la Srta. Gutirrez fue excelente. Ella nos ayud a prepararla!A. lllgicoB. Lgico9. La abuelita de mi amiga Idalia naci hace dos das.A. lllgicoB. Lgico10. Alrededor del museo haba estatuas antiguas y modernasA. lllgicoB. LgicoHelp please Suzie looked at the diagram at right and wrote 134%=134/200. Is she correct? It is important to consider the social, emotional, physical, and economic effects of teen pregnancy on the teen parent, the child, the family, and society. Think about your goals for the future and how they could be affected by teen pregnancy. Use this decision-making process document to help brainstorm your ideas and organize your thoughts. Then respond to the prompt. the half-life of roentgenium -281 is 17 seconds,if 10 grams are left after 85 seconds,how many grams were initially in the original sample? Find the midpoint of the line segment with endpoints (-3, 2) and (1.-2)A)(-1,0)B)(0, -1)(-2,0)D)(0, -2) The radius of a circle is 11 millimeters. What is the circle's circumference? Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG The Know-Nothing Party opposed which of the following? 1) What is your Dawn Wall and how are you approaching it? What is the expected outcome? (Or, reflect on a 'Dawn Wall' in your past and discuss how you overcame it.)2) Describe a few things that Kevin and Tommy had to overcome to realize their goal. (Or, describe what things had to be in order or exist for their goal to be realized.) Which of the following ions is formed when a base is dissolved in a solution? H+ O OH SO42+ 1) What percentage of oxygen and carbondioxide inhaled and Exhaled Air ? .. A. Suriin kung anong panghalip panao na ginagamit sa pangungusap.1. Sila ay magsisimba.2. Hiniwa niya ang tiyan ng manok.3. Ako ay mag-aaral sa Tiptip ng Elementarya.4. Ikaw ay kasama ko. why is this wrong and what is the right answer? Which statement describes Keplers third law of orbital motion? Which of the following is the definition of geometric sequence?A. an ordered set of numbersB. an element in a sequenceC. a sequence in which terms are given by multiplying the previous term by a common ratioD. a sequence in which terms are not given by multiplying the previous term by a common ratio escride otra vez este texto pero con los verbos en pretrito perfectoMe levanto (1) a las ocho, preparo (2) un caf y me ducho (3). Salgo (4) de casa a las 8.30, tardo (5)cuarenta minutos en llegar a la universidad; en el autobs leo (6); el autobs va (7) lleno de gente y es (8)muy incmodo.Estoy (9) en la facultad desde las 9.30 hasta las 14.00, pero no voy (10) a todas las clases porque estoy(11) cansada. Despus, como (12) con mi amiga Helena y ms tarde tomamos (13) un caf en la cafeterialde la facultad. Vamos (14)........ a la biblioteca y estudiamos (15)..un rato.Vuelvo (16) a mi casa a las 20.00; veo (17) la tele un rato, ceno (18) y juego (19) un poco con mi ordenador.Hablo (19) por telfono con mi novio y me acuesto (21) a las 24.00. Question poIn an auditorium, a charity show is conducted in order to raise at least $3,000. The auditorium canaccommodate up to 180 spectators. Tickets cost $12 for students and $20 for adults. Identify the system ofinequalities and the corresponding graph that determine whether the charity will reach its goal. Steam Workshop Downloader